The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b. 5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] b. Tyr - Arg - Met - Phe - Thr - [STOP] C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above

The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b. 5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] b. Tyr - Arg - Met - Phe - Thr - [STOP] C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above

Name: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT -
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would beproduced from transcribing this DNA template strand?a. 5' - TATCGCATGTTCACCTAA - 3'O b.5' - UAUCGCAUGUUCACCUAA - 3'c. 5' - AUGUUCACCUAA - 3'd. 5' - UTGTTCUCCT

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 6RQ: A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA...

See similar textbooks

Similar questions

f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequence
Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′
How do we call the type of point mutation in which an A->U change occurs in the codon for the sixth amino acid in hemoglobin chain b? a) Inversion b) Transversion c) Transition d) Transamination
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT
Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU
Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?
The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.
Which of the following would be most likely to cause a mutation? A. the addition of nucleotides to the 3’ end of the growing strand B. the insertion of a mismatched nucleotide into a DNA strand C. the unwinding of the DNA strand D. the synthesis of short stretches of DNA