Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below? 5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A. 3′-ACTGTTAGA-5′ B. 3′-AAATTTGGC-5′ C. 3′-ATGCTTTGA-5′ D. 5′-GGGACCCGA-3′ E. 5′-CCCTGGGCT-3′

Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below? 5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’ 3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A. 3′-ACTGTTAGA-5′ B. 3′-AAATTTGGC-5′ C. 3′-ATGCTTTGA-5′ D. 5′-GGGACCCGA-3′ E. 5′-CCCTGGGCT-3′

Name: Which of the strands of DNA could act as a PCR primer for the DNA sequ
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the strands of DNA could act as a PCR primer for the DNA sequence shown below?5’-CCCTGGGCTCTGTAAATGTTTCTAAGTG-3’3’-GGGACCCGAGACATTTACAAAGATTCAC-5’ A.3′-ACTGTTAGA-5′ B.3′-AAATTTGGC-5′ C.3′-ATGCTTTGA-5′ D.5′-GGGACCCGA-3′ E.5′-CCCTGGGCT-3′

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1FIO

See similar textbooks

Similar questions

1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
Which of the following represents a missense mutation in the DNA coding strand sequence, 5' - AAACCTTTT - 3'? a) 5' - AAACCCTTT - 3' b) 5' - AAACCATTT - 3' c) 5' - AAACGTTTT - 3' d) 3' - AAACCTTTT - 5' e) 5' - AAACCGTTT - 3'
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'
A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
Select the sequences that would be recognized by a restriction enzyme? (There can be more than one answer) A) 3'-TAGCTA-5' B) 5'CGATTC-3' C) 5'GAATTC- 3' D) 5'GAGCTC-3'
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis. Which fragment will migrate farthest in the gel? a. The 2000-bp fragment b. The 1000-bp fragment c. The 500-bp fragment d. All will migrate equal distances.
Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertion
A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5′–TAGTTAAAAC–3′ Fragment 2: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 3: 5′–CCCTAGTTAAAAC–3′ Fragment 4: 5′–ACCGCAATACCCTAGTT–3′ Fragment 5: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 6: 5′–ATTTACCGCAAT–3′ On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.