Order the following from 1-12 events chronologically based on the next generation sequencing methodology:
Q: In the given below option which of the following are considered as the main tools for DNA…
A: DNA technology alters the phenotype of the organism through a genetically altered vector. It…
Q: compare and contrast DNA replication in the cell with PCR-based replication in the lab. Do these two…
A: DNA replication vs pCR(polymerase chain reaction). *DNA replication is a process that produce two…
Q: The human genome is made from more than 3 billion nucleotides. How many sites (loci) are…
A: According to the question, The human genome is made from more than 3 billion nucleotides. How many…
Q: The drug Celebrex selectively inhibits PTGS2 while aspirin and other NSAID’s inhibit both PTGS1 and…
A: Prostaglandin- endoperoxide synthase (PTGS) is also called as cyclooxygenase which helps in…
Q: There are three basic steps of DNA extraction: cell lysis, separation, and extraction. In the…
A: Extraction of DNA from a cheek cell: First of all the sample of cheek cells is collected, this can…
Q: issing Piece Direction: Supply the missing word to complete the paragraphs. Get the word from this…
A: According to the question Have to fill in the blanks. Genetic engineering is used to modify the…
Q: 1. A fermentation method used by several industries like the pharmaceuticals, food, textile etc., to…
A: Solid state fermentation (SSF) is the type of microorganisms fermentation technique where solid…
Q: On paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGG CTACGITCAC…
A: Replication is the process of making two similar DNA units from a double-stranded DNA molecule.…
Q: Refer to the image and answer the questions. 1. Which among the two strands will have a continuous…
A: A replication fork is formed when double-stranded DNA molecules are separated into single strands…
Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…
A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…
Q: How many cycles of PCR are needed to obtain 512 amplicons? O 7 0 9 O 6
A: PCR is a revolutionary approach developed by Kary Mullis in the 1980s. PCR is based on the use of…
Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…
A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…
Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…
A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…
Q: Which would need to occur to replicate DNA? (select all that apply) Group of answer choices the…
A: DNA replication is the process by which the double-stranded DNA molecules replicate to produce…
Q: Define the following terms: Genome Bacteriophage λ DNA
A: 1) Genome - Genome is the whole set of genetic instructions found in a cell. It has all the…
Q: Select the statement below that is FALSE regarding DNA and DNA Fingerprinting: Select an answer and…
A: Each individual is unique because of his DNA sequences. Determining the DNA sequences by cutting…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: Put the following processes in the correct order that represents one cycle of polymerase chain…
A: The correct order is Denature DNA Anneal primers Extend primers
Q: Put the following pieces of DNA in order that they would appear reading from the top (nearest the…
A: First of all lets convert all of them into single unit 1kb = 1000bp So, 21000bp =21kb 10000bp = 10kb…
Q: 1. You are a research assistant in a renowned science academy. Your supervisor requires you to…
A: PCR:- it is used to amplify the fragments of a DNA or gene of interest. Gene cloning:- it is a…
Q: Which of the following is TRUE of next generation sequencing technology? It is required for CHIP-seq…
A: Next generation sequencing (NGS) is a massively used sequencing technology that has revolutionized…
Q: Choose the correct letter and explain why you choose it. thanks Which order is correct for…
A: ATP is Adenosine triphosphate. By its name, it means this molecule has three phosphate bonds.…
Q: Write the term or phrase that best completes each statement. Use these choices: gel electrophoresis…
A: PCR is biochemical research technique developed in 1985 by Kary Mullins. It is based on the…
Q: how enzymes are involved with proofreading newly formed DNA molecules. 1. DNA polymerase does not…
A: In proofreading process, The polymerase checks whether the recently added base has matched…
Q: DNA fingerprinting involves using restriction enzymes to cut DNA at a specific sequence, resulting…
A: DNA fingerprinting: DNA fingerprinting is a technique that involves the isolation of genetic…
Q: SANGER SEQUENCING NEXT GENERATION SEQUENCING WRITE A PRECISE AND ACCURATE DIFFERENTIAL REPORT ON…
A: sanger sequencing and next-gen sequencing is that the sanger method only sequences a single DNA…
Q: The following DNA fragment was sequenced by the Sanger method. The red asterisk indicates a…
A: DNA polymerase is an enzyme that catalyzes the synthesis of DNA molecules from nucleoside…
Q: 1. What are the materials used for the polymerase chain reaction? 2. Draw a schematic diagram of…
A: The polymerase chain reaction process is used for the amplification of desired target DNA…
Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…
A: Gel electrophoresis refers to the separation technique that involves the separation of charged…
Q: How PCR may be used for the detection of disease–causing pathogens in a population during COVID…
A: In PCR, the infected gene is amplified and allows them to bind with the complimentry strand. After…
Q: You are studying a genetic disease and trying to determine its location on a chromosome using…
A: Gel electrophoresis is used to separate the DNA fragments on the basis of their size.
Q: In which sequencing method, DNA is labelled and then chemically cleaved in a sequence-dependent…
A: DNA sequencing refers to decoding the base sequence of the DNA strand. It tells us the base…
Q: Define the following terms:a. PCRb. DNA microarrayc. chromosomal jumpingd. genome projecte.…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: What causes microsatellites to be polymorphic?
A: Microsatellites are classified as variable number tandem repeats. These are 2-13 nucleotide long…
Q: DNA fingerprinting involves using restriction enzymes to cut DNA at a specific sequence, resulting…
A: DNA fingerprinting is a technique to distinguish between individuals of the same species using…
Q: Analyze the validity of the given statement. Type the word true if the statement is correct. If the…
A: Q1 false - in 3 prime end the nucleotides are added by rna primers Q2 true Q3 false - ap site is…
Q: Give three advantages ‘Next Gen sequencing’ has over Sanger sequencing for clinical microbiology.
A: Nucleotide sequencing is the way of assessing the proper sequence of nucleotides in a given…
Q: create a concept map illustrating the relationships among these key terms: 1. Foreign DNA; 2.…
A: Recombinant DNA technology is the combining of DNA molecules from two different organisms. This…
Q: Draw your own series of labelled diagrams to describe the polymerase chain reaction (PCR) and its…
A: PCR is Polymerase Chain Reaction used for the amplification of a given molecule of DNA in vitro.…
Q: Analyze the validity of the given statement. Type the word true if the statement is correct. If the…
A: During replication of DNA, DNA polymerase can not initiate the synthesis of DNA from scratch. It…
Q: The Human Genome Project attempts to modify organism’s DNA inserting desired genes into bacteria.…
A: The human genome project (HGP) aims to sequence the whole human genome (3 billion base pairs)…
Q: Starting with one double-stranded DNA, what is the total number of double-stranded DNA after 5…
A: PCR (polymerase chain reaction):- it is a mechanism to amplify the segment of DNA into millions or…
Q: Use the diagram to answer the following three questions. 5' TTAGGGITAGGGTTAG 3' || CAAUCCCAAUC…
A: (a) Write next six bases that would be added by telomerase using the format 5'NNNNNN3'…
Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…
A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…
Q: deduce the DNA sequence based on the following electrophoreograms.
A: The electrophoretic technique is used to separate proteins, DNA, and RNA based on their size and…
Q: RECOMBINANT DNA • Recombinant DNA molecules are sometimes called chimeric DNA. • The DNA sequences…
A: Recombinant DNA technology is very commonly used in laboratories that is responsible for the…
Q: 1. Electrophoresis is a method of (highlight the correct answer) (1) separating DNA fragments (2)…
A: The need to study different aspects of an organism’s physiological activities, cause of disease and…
Q: Exit Ticket: Use the diagram below to answer the following questions. DNA Samples 1 2 3 4 5 6 7…
A: 1. The given diagram is the technique known as gel electrophoresis. By this technique the DNA, RNA…
Q: Suppose that you are given a short fragment of DNA to sequence. You amplify the fragment with PCR…
A: DNA sequencing is a method to determine the sequence of the DNA molecule. Electrophoresis enables…
Q: You discovered that a species of bacteria can break down Styrofoam™ (polystyrene) products due to an…
A: DNA is the genetic material present in the nucleoid of bacteria.
Order the following from 1-12 events chronologically based on the next generation sequencing methodology:
___ the next fluorescent
___ the attached nucleotide's fluorescence is detected
___ the computer software assembles overlapping sequences to reconstruct the whole genome
___the DNA fragments are denatured into single strands
___the blocking and fluorescent probe is removed
___the complimentary strands are clipped from the patches of amplified DNA
___ cellular DNA is fragmented
___the free fluorescent nucleotides are washed away
___a primer is attached to the adaptor and a polymerase adds a fluorescently-labeled nucleotide
___ the attached fragments are amplified via PCR
___DNA fragments are ligated to adaptors
___the DNA fragments are captured into a solid surface using complimentary oligonucleotides
Step by step
Solved in 2 steps
- Order the following technical steps that are required to identify a bacterium by PCR and sequencing of the 16S rRNA gene. [1 mark] - Carry out thermal cycling (amplification) of the PCR - Checking the PCR product (amplication) by agarose gel electrophoresis - Purify the PCR product - Perform a DNA extraction - Sequence the PCR product(Sanger sequencing) - Grow a fresh overnigh liquid culture - Obtain a pure bacterial culture - Set up a 16S Rrna gene PCR - Perform bioinformatic analysis (BLAST)Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.Match the following terms with their definitions and label each component of the PCR mixture in the diagram (use the letters A-D):I. DNA polymeraseII. PrimersIII. NucleotidesIV. Genomic DNA template A. DNA that contains the target sequence that will be replicated using PCR.B. An enzyme that copies the DNA sequence.C. A mixture of 4 nucleotides (A,G,C, and T) that will be polymerized into the replicated DNA sequence.D. A short DNA sequence that allows the enzyme to bind and initiate polymerization.
- Copy and paste the link below and watch the video on Youtube and Answer the Questionshttps://www.youtube.com/watch?v=g-dNJdOvBM4 Polymerase Chain Reaction Questions: 1. What are the materials used for the polymerase chain reaction? 2. Draw a schematic diagram of the procedure in PCR. 3. Why is it important to design the primers at the start of the laboratory procedure? 4. What are the components of the PCR buffer and what is its pH range? What is the purpose of the buffer? 5. What is the use for magnesium chloride? 6. How much template DNA is added? What is the concentration of the primers? 7. At what temperatures does denaturation, annealing and extension occur? Why are the processes placed in that temperature? 8. In this particular PCR experiment, how many cycles was used? 9. Can this PCR be used on its own to find out if a person has Covid or not on its own? Why or why not?Analyze the validity of the given statement. Type the word true if the statement is correct. If the statement is incorrect, type false and choose ONLY the word or phrase that made it incorrect. Use a hyphen to separate your answer. ????????:Manila is the capital of the Republic of the Philippines. ➡️ Type: TrueBeijing is the capital of the Republic of the Philippines. ➡️ Type: False-Beijing (no spacing) 1. RNA primers provide the free five prime phosphate end for the DNA processive enzyme to produce the daughter strand. 2. Among prokaryotes, the unwinding of the DNA material results to the formation of four replication forks. 3. GATC endonuclease removes the single mismatched bases in nucleotide excision repair.Choose the single most appropriate description of how most Next Generation sequencing methods work. Template DNA is attached to 'chips', free di-nucleotides are added to synthesise new DNA, computers read the results. Template DNA is attached to 'chips', di-deoxy nucleotides are added to synthesise new DNA, computers read the results. Sample DNA is broken into short fragments and synthetic oligonucleotides are added to them. They are bound to a membrane and sequenced using lasers. Sample DNA is broken into short fragments and synthetic oligonucleotides are added to them. The fragments are then bound to a membrane and sequenced using light emission as the reporter. Sequencing by synthesis of short template fragments, using various 'reporters' and computing power to rebuild lengthy sequence data in silico using reference genomes. Sanger sequencing of short fragments, using various 'reporters' and computing power to…
- What molecular biology technique is used to amplify DNA from an evidence sample? Reverse dot blotting Southern hybridization Cloning Polymerase chain reaction (PCR) Capillary electrophoresisThe illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/Which of the following organism has the fastest rate of renaturation of genome DNA? Please explain why? Question options: virus bacteria animal cells none of the above
- Which of the following statements is true of a Sanger sequencing reaction but not colony PCR? Select all that apply. Must contain only a single primer ddNTPs are added Uses a heat stable DNA polymerase Requires a pair of primers that bind to opposite strands Requires temperature cyclingWhich of the following is involved in recombinant DNA technology? Explain. MULTIPLE CHOICE. Choose only one: a. DNA polymerase b. DNA probes c. Restrition enzymes d. Reverse transcriptaseWhich of the following is true regarding next generation sequencing? 1. Next generation sequencing is also known as sequencing by synthesis 2. Next generation sequences uses DDNTPS to identify the base at the end of the nucleotide chain 3. Next generation sequencing will not work if chain terminating nuclear tides are included in the reaction 4. Next generation sequences uses fluorescently labeled ddNTPs instead of radioactivity labeled ddNTPs 5. Next generation sequencing allows hundreds of millions of DNA fragments to be sequenced at the same time
