The following step takes place in the Krebs cycle (actually it's two steps but we will assume it is one). CO: NAD* NADH a ketoglutarate Succinate Н.О GDP GTP АТР ADP Fully explain the events taking place in this step. Be sure to use proper scientific terminology when describing the event. You may use a point form list.
Q: ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein…
A: pGLO: pGLO is an engineered plasmid that contains genes for beta- Lactamase. Beta-lactamase…
Q: indicators, key used for/ determines reagents, or key positive result ingredients |1. crystal violet…
A: Different types of culture media are used to support microbial growth and various test performed to…
Q: ECOR1 cuts Plasmid T into 3 pieces. Feeling grumpy at your professor (☹), you decide to take a…
A: Introduction A plasmid is a little extrachromosomal DNA molecule that can replicate independently of…
Q: Double fertilization results in __________________________. a. a diploid zygote and triploid…
A: In flowering plant reproduction, double fertilisation is the union of the egg and sperm, as well as…
Q: ➢ Is the tripartite body plan of phoronids advantageous for them? Why or why not? ➢ Why is the…
A: Phoronids Phoronids are also known as horseworms. These are small marine organisms of the animal…
Q: Pathogens have a variety of traits that interact with a host and enable the pathogen to enter a…
A: A pathogen is an organism that is capable of causing disease in an organism. It is also known as an…
Q: Teratology is the study of exogenous chemical compounds (teratogens) that have the capacity to cause…
A: Teratogens are chemicals or physical agents taken during the pregnancy that harms the growth and…
Q: How are biogeochemical cycles interconnected
A: Introduction :- A biogeochemical cycle (or, more broadly, a matter cycle) is the process through…
Q: A worker in a nuclear power station receives the following radiations while working in 1 year: 85mGy…
A: Introduction :- Radiation is energy that originates from a source and travels at the speed of light…
Q: 42)There is but a single enzyme-catalyzed reaction in the human body known to generate carbon…
A: Enzyme is a biomolecule which converts substrate into product by reducing activation energy of…
Q: Why are Amphotericin B and Azoles selectively toxic for fungus? (Define selectively toxic and…
A: A fungus is a type of eukaryotic organism which comprises microbes like yeasts and moulds, as well…
Q: Please help explain this sentence Identification of DAXX as a restriction factor of SARS-CoV-2…
A: To identify restriction factors limiting SARS-CoV-2 replication, we generated a pool of A549-ACE2…
Q: 12. The CFTR gene, on hu chloride ion concentrat cystic fibrosis. How ma In G1 of the cell cycle In…
A: Phase Number of gene/chromosomes G1 phase of cell cycle- 2 copy G2 phase of cell cycle…
Q: worm Disease Produced Infective stage Mode of Transmission Intermediate and definitive host enolepis…
A: Hymenolepis nana and dimunita are the species of tapeworm. H. dimunita has slightly bigger eggs and…
Q: Diseases of the female reproductive system are generally treated by a physician called a The male…
A: The testes are important for creating sperm and manufacturing testosterone, the principal male sex…
Q: Give the meanings for the following conditions: 11. hyponatremia - 12. polydipsia - 13. glycosuria -…
A: Medical biology is a branch of medicine which use laboratory methods (analysis, microscopy,…
Q: Why should people care about the article "Stopping pandemics before they start: Lessons learned from…
A: SAR-COV-2 virus is a member of a large family of coronavirus. It affects the respiratory system of…
Q: Where do invertebrates fit into the evolution history of eukaryotes? Of animals?
A: The study of relationships between distinct groups of species and their evolutionary development is…
Q: Moving from 3’ to 5’ along the sugar phosphate backbone of a single strand of nucleic acid, the…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: Discuss how Genome-wide association studies (GWAS) can be used to identify genetic risk loci for (a)…
A: GWAS helps in screening the genome across the databases to find the desirable results without having…
Q: Which one of the following statements about the propagation of the action potential is incorrect? O…
A: The action potential is any shift in the membrane potential due to an increase or decrease of…
Q: Glycophorin, a protein in the plasma membraneof the red blood cell, normally exists as a homodimer…
A: Hydrophobic means water repelling. There are certain amino acids in a protein which poses…
Q: What role does the human microfauna play in protecting humans against pathogens? (At this point in…
A: The human host and its microbial flora form a complex ecosystem whose balance is a striking example…
Q: Calculate how much agarose is needed to make a 3% agarose gel in a volume of 150 ml 1x TAE buffer.
A: Introduction Agarose gel electrophoresis is a type of gel electrophoresis used in biochemistry,…
Q: Mendel’s observation that two different traits could be inherited independently of each other can be…
A: Genes on distinct chromosomes will be transmitted separately. When Mendel mated peas with many…
Q: What is Reproductive (Male/Female) body system? What are the functions and major organs ? Describe 2…
A: The male reproductive system is responsible for producing and depositing sperm, whereas the female…
Q: Explain the monoamine theory for the etiology of major depression.
A: The Monoamine Theory of Mental Depression states that the low levels of norepinephrine and serotonin…
Q: How many clades are represented in Figure 20?
A: Clade A clade is a graphic representation of group of organisms that includes it's ancestor as well…
Q: Consider the following protein sequence as an α helix:…
A: The sequence and identity of amino acids of a polypeptide chain make its primary structure.
Q: indicators, key used for/ determines reagents, or key positive result ingredients |1. crystal violet…
A: NOTE: Once you have posted a question that has multiple subparts, we will be solving the first three…
Q: Choose from the following list the systems involved in assisting protein folding in vivo (more than…
A: Protein folding is a process by which linear polypeptide chains fold into its functional…
Q: Human immunodeficiency virus (HIV) preferentially destroys CD4+ cells. Specifically, what effect…
A: Introduction Human immunodeficiency virus (HIV):- It is a retrovirus that when infects a person…
Q: greater omentum [Choose Jh [ Choose] Parietal peritoneum holds the small intestines medial borrder,…
A: Digestive system is responsible for uptaking of food and digestion and absorption of food. The…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: What is the purpose of the "sodium/potassium pump" A. to perform endocytosis. B. to move sodium and…
A: Sodium/potassium pump: The sodium/potassium pump is referred as an enzyme that is found in the…
Q: How do antibodies work to eradicate pathogens?
A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…
Q: Why do people age? What makes us go through so many physical changes?
A: Introduction The physiological changes we go through as we age are referred to as ageing. It is…
Q: By looking at the picture above, describe the events that take place during fertilization up to the…
A: Fertilisation is q process of fusion of male and female games resulting in the formation of a…
Q: 2.) One experimental tool used in the biological research and in clinical settings is called…
A: FACS/ Fluorescence-activated cell sorting (FACS) is a specialized type of flow cytometry, which…
Q: Why is pH important for the buffer? The pH is important to the stability of the gel. The pH…
A: @ Why is pH important for the buffer? Answer - pH is important for buffer for processes and/or…
Q: What feature of the skin creates a physical barrier to microbial invasion? Group of answer choices…
A: Introduction:- The covering, or integument, of the body's surface that simultaneously offers…
Q: ORIGIN 1 acacttgctt ctgacacaac cgtgttcact agcaactaca caaacagaca ccatgctgac 61 tgctgaggag aaggctgccg…
A: The gene contains information to code for specific proteins in the form of the nucleotide sequence.…
Q: Explain, in detail, how tyrosine kinase proteins are involved in one signal transduction pathway of…
A: The signal transduction pathways in cell occurs via three types - G protein couple receptors,…
Q: The habit of a perennial plant's dropping its leaves, which have all died, at the end of the growing…
A: The answer is d. Deciduous
Q: 5. View the protists blood parasites (Trypanosoma cruzi, Trypanosoma brucei, and Plasmodium vivax).…
A: Trypanosomes are zooflagellate protozoans that are obligate parasites that can cause parasitic…
Q: A male and a female hedgehog escape from separate cages in a pet store. They both have gray…
A: Let, G - allele for gray bristles and g - allele for whitish bristles
Q: What is an example of a lab experiment that shows the variation of the photosynthesis efficiency in…
A: Introduction - The fraction of light energy turned into chemical energy during photosynthesis in…
Q: Some sperm mitochondria enter an egg during fertiliza- tion, but as sperm mature these mitochondria…
A: Fertilization in humans refers to the fusion of male and female gametes that facilitates the…
Q: Explain whether Person O finds the carved initials higher relative to ground level after ten years.
A: Introduction Plant growth is described as the increase in volume and/or mass of a plant, with or…
Q: Define and describe the stressors that may induce Artemia cysts to a state of dormancy How does the…
A: Introduction Artemia, popularly known as brine shrimp, is a genus of aquatic crustaceans. Artemia is…
Step by step
Solved in 2 steps
- Urea formation is energetically expensive, requiring theexpenditure of 4 mol of ATP per mole of urea formed.However, NADH is produced when fumarate is reconvertedto aspartate. How many ATP molecules are produced bythe mitochondrial oxidation of the NADH? What is the netATP requirement for urea synthesis?Which of the following statements is/are TRUE for the Krebs' cycle? Reaction 1: condensation of acetyl-CoA and oxaloacetate; produces H20. Reaction 3: oxidation of isocitrate to a-ketoglutarate; produces NADH and CO2. Reaction 6: oxidation of succinate to fumarate; produces FADH2 and CO2 Reaction 5: hydrolysis of succinyl-CoA to succinate; produces ATP.Given the following question, for each of the three reactions catalyzed by NADH dehydrogenase complex, identify the following1. electron donor2. electron acceptor3. the reducing agent4. the oxidizing agent
- In the krebs cycle, if the enzyme used succinate dehydrogenase used NAD+ as the oxidizing agent, what impact would it have on the overall production of ATP in the call?Designate the reactions catalyzed by the following enzymes:a. aldolaseb. enolasec. hexokinased. amylo-a(1,6)-glucosidasee. phosphoglucomutaseIdentify the Krebs cycle enzyme that consumes a six-carbon substrate molecule, producing a six-carbon product molecule, but neither consumes nor produces NADH? A. a-ketoglutarate dehydrogenase B. isocitrate dehydrogenase C. succinyl CoA synthetase D. malate dehydrogenase E. aconitase
- Given what you know about the involvement of nicotinamide nucleotides inoxidative and reductive metabolic reactions, predict whether the followingintracellular concentration ratios should be 1, > 1, or < 1. Explain youranswers.(a) [NAD+] >[NADH](b) [NADP+] >[NADPH](c) Since NAD+ and NADP+ are essentially equivalent in their tendency to attract electrons, discuss how the two concentration ratios might bemaintained inside cells at greatly differing values.Name two conditions in which the enzymes involved in the TCA cycle might be inhibited.Suppose a patient has correctly diagnosed GALT (galactose-1-phosphate uridylyltransferase) deficiency. Would this patient have lower steady state levels of NADPH in the presence of normal steady state glucose levels? Why is NADPH an important byproduct of the pentose phosphate pathway anyways?
- Name two oxidizing agents that act as coenzyme with oxidoreductasesOne process catalyzed by NADHNADH dehydrogenase is NADH+H^++ubiquinone ↽−−⇀ NAD+ubiquinolNADH+H^++ubiquinone ↽−−⇀ NAD^++ubiquinol The standard reduction potentials for the half‑reactions are given in the table. Oxidant Reductant ?′0 ubiquinone+2H++2e−ubiquinone+2H++2e^− ubiquinolubiquinol 0.045 NAD^++H^++2e−NAD^++H^++2e^− NADHNADH –0.32 Calculate Δ?′0 for the reaction as shown. Δ?′0=____(V) Calculate Δ?′0 . Δ?′0=____(kJ/mol)The malaria parasite Plasmodium falciparum does not carry out oxidative phosphorylation and therefore does not use the citric acid cycle to generate reduced cofactors. Instead, the parasite converts amino acid–derived α ketoglutarate to succinate. Write an equation for the α-ketoglutarate → succinate conversion that follows (a) the oxidative (clockwise) path of the citric acid cycle or (b) the reductive (counterclockwise) path of the cycle.