The following table shows the caloric values of three types of food in kilocalories per gram of food: Food type Carbohydrates Fat Caloric value 4 kcal 1g 9 kcal 1g Protein 4 kcal 1g Part A How many nutrition bars should Alexandra pack? Express the number of bars numerically. View Available Hint(s) Alexandra decides to climb Mt. Krumpett, which is 5000 m high. She determines that this will require a total of 1350 kcal of energy for the trip. For her food supply, she decides to take nutrition bars. The label states that each bar contains 50g of carbohydrates, 10 g of fat, and 40 g of protein

Q: a B B A C B 7 B e y p The figure above shows images of five different cells. Each box contains an…

A: Mammals including humans show XY sex determination system in which the presence of Y-chromosome is…

Q: Describe how NADH transfers electrons to electron transport proteins of the ETS and ultimately to…

A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…

Q: 1 and 4 3 and 4 4 1 and 3 3 In the diagram, myelinated neurons are represented by the numbers O2 and…

A: The brain, spinal cord, and a sophisticated nerve network are all parts of the nervous system. The…

Q: Based on morphological data, explain which early euprimate is thought to be ancestral to modern…

A: The study of early euprimates, the group that incorporates modern primates and their closest extinct…

Q: In the graph, what is the carrying capacity of the deer in this particular environment?

A: The species population size depends on various biotic and abiotic factors like adequate food,…

Q: How many clades are there in this phylogeny?

A: A phylogenetic tree is a diagram which is used to represent and study evolutionary relationships…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: carry the father’s genetic information

A: Genetic infromation refers to the informations which is stored in the DNA. DNA can code for proteins…

Q: Consider a gram negative pathogen isolated from marine mammals. This pathogen is subjected to a…

A: Here in this question we are given certain characteristics and on the basis of it we have to…

Q: What are the 3 components of total energy expenditure (TEE)? In the component that makes up the…

A: Total energy expenditure (TEE) is the amount of energy used in a 24-hour period during the oxidation…

Q: Explain the relation between muscles, ATP energy, and the calcium ion.?

A: Muscle consists of muscle fibres/cells , made up of myofibrils containing myofilaments , actin and…

Q: Cockroaches from the dormitories at Texas A&M University usually weigh about 1 gram. However, about…

A: This is an example of polygenic inheritance where several genes are involved to give rise to a…

Q: Predictors of Eating Disorders Which of the following is the most important predictor of an eating…

A: Eating disorders are intricate battles within the mind. In these types of disorders, there is…

Q: Sympathetic ganglia are proximal to the effector organs and glands are located distal to the spinal…

A: In the intricate web of the human nervous system, the sympathetic ganglia hold a significant place.…

Q: A detailed explanation of respiration under physiological processes in plants.?

A: Like animals and humans, plants do breathe. It is a crucial physiological process that takes place…

Q: Regarding data from the fossil record, morphological change in the same direction over time (e.g.,…

A: The question revolves around the interpretation of data from the fossil record, specifically in…

Q: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…

A: Leopards are seen in a variety of patterns: spotted, black, and tan. Examine the following crosses…

Q: efer to the image. A HAURS Gibbon (20 species in 4 genera) Prosimians: Bushbabies New World and…

A: It is a diagram that shows the evolution of various species, organisms from a common ancestor. It is…

Q: In a DNA double helix, where would you find hydrogen bonds? Between the bases connecting the…

A: DNA or deoxyribonucleic acid is one of the two nucleic acids that serve as the genetic material of…

Q: se #1: The Story of the Peppered Moth reat Britain, prior to the 1800s, most peppered moths had…

A: Evolution is the accumulation of different kinds of adaptations over a period of time which can give…

Q: When completing a chart showing the organization of the nervous system, which term should be written…

A: The central nervous system ( CNS) comprises the brain and the spinal cord. The peripheral nervous…

Q: Hormones Affect only other hormone producing organs Remain at a constant concentration in the…

A: Endocrine system involves different glands that contains several specialised cells. These cells…

Q: In Drosophila fruit flies, the gene controlling bristle length is X-linked. Wild type flies have…

A: In this particular scenario, we’re examining a gene that controls bristle length, which is X-linked.…

Q: Match the organelle/cellular component to its function: Contains enzymes that break down and digest…

A: 1.Cystosol - jelly like fluid inside the cell2. Ribosome - helps in synthesis of proteins.3. Smooth…

Q: Cats can have tabby coloration (T) or can have white fur (W). There is also variation in hearing…

A: Cats can have tabby coloring (T) or can have white fur (W).There is also variation in hearing…

Q: Why is the formation of ATP by ATP synthase referred to as oxidative phosphorylation?   A. A…

A: The final step in cellular respiration is oxidative phosphorylation. It takes place in the…

Q: two mutational events are sufficient to cause some forms of cancer, what distinguishes familial…

A: Generally, individuals inherit one mutation that can increase the chances of cancer. This mutation…

Q: Zygote Cleavage (Blastula) Cleavage (8-cell stage) Early Gastrula

A: The development of an organism begins after the fertilization process. Fertilization involves fusion…

Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…

A: Evolution is the gradual process through which living organisms change over time, typically due to…

Q: 2. Results 2.1. Flow Cytometry with Canine CD Markers Flow cytometry analyses confirmed that the…

A: The study delves into the fascinating world of canine bone marrow-derived mesenchymal stem cells…

Q: You become interested in monarch butterfly conservation and begin investigating milkweeds (genus…

A: The initial stage in the construction of a phylogenetic tree involves the meticulous analysis of DNA…

Q: The ______ controls most of the autonomic nervous system functions and is considered the main…

A: The diencephalon of the brain contains the hypothalamus, which is a crucial regulatory region for a…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Lipid metabolism is the process by which the body breaks down and synthesizes lipids. Lipids are a…

Q: Let S and s be the alleles for seed shape (spherical and wrinkled, respectively) in garden peas.…

A: Trait is a characteristic feature that is unique to a specific individual. Each trait is represented…

Q: Which of the following is TRUE about gametes? a) undergo meiosis b) formed by mitosis c) always…

A: Please note, the given questions are four different questions and not sub-parts of one question.…

Q: 1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions?…

A: Plasmids are extrachromosomal DNA molecules. They are small, circular, and capable of…

Q: In fruit flies, gray is dominant over ebony body color and wild is dominant over curled wings.  A…

A: In genetics, a test cross is a cross that involves an individual of interest, usually with an…

Q: The hairless gene allele, H, in fruit flies, causes fruit flies to lack sensory hairs.  The H allele…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Briefly describe how thyroid hormones is made in the thyroid gland. What are the necessary…

A: The synthesis of thyroid hormones in the thyroid gland is a complex and highly regulated process…

Q: A new class of cholesterol-lowering treatments that utilize small interfering RNAs (siRNAs) are…

A: siRNA, also known as short interfering RNA or silencing RNA, is a class of double-stranded RNA…

Q: Question 37 of 45 Macmillan Learning The phrases or terms describe different fundamental processes…

A: Replication is the process in which both strands of DNA are copied to create two identical DNA…

Q: Question 1 All are true about the microbiome except? O secrete exotoxins O out-compete pathogens for…

A: The microbiome is made up of bacteria that can be both beneficial and detrimental. The majority are…

Q: C6H12O6

A: C6H12O6:This is a glucose molecule.It is a vital carbohydrate and primary source of energy for…

Q: estion 34 of 45 P Pre-mRNA mRNA 30 31 Coding segment 104 105 RNA Splicing Use the diagram to select…

A: When a gene is expressed to make a protein, it first creates a molecule called pre-mRNA. This…

Q: Baker's yeast, Saccharomyces cerevisiae, is a single-celled, diploid fungus (which is, of course, a…

A: Note :- "since you have posted multiple questions we will provide the solution to the only first…

Q: Which of the following statements about the protein quality control system in the endoplasmic…

A: Endoplasmic reticulum is present in the cytoplasm, is a continuous membrane system consisting of…

Q: In albinism, the formation of melanin, a dark skin pigment, are blocked so that albinos

A: Albinism is a genetic condition that affects the production of melanin, the pigment responsible for…

Q: Drag each label into the appropriate bin. Reproduces its own kind Requires another individual to…

A: An earth ecosystem consists of both living and non-living organisms. The abilities for interaction,…

Q: Create a visual representation, or a diagram, of the concepts in respiration and photosynthesis. You…

A: Photosynthesis: The process by which green plants produce oxygen and energy in the form of sugar in…

Q: A woman without red-green colorblindness and with a normal chin, whose mother was colorblind,…

A: Genetic inheritance patterns come in two flavors: autosomal dominant and sex-linked recessive. The…

Nutrition and diet

We are involved in several daily activities. These actions need a significant quantity of energy. The food we eat provides this energy. Food is necessary for development, repair, and other living activities since it supplies energy. All of these are part of the living practice known as nutrition. Nutrition is the study of nutrients in food, how the body uses them, and the relationship between diet, health, and disease. Nutritionists employ concepts from molecular biology, biochemistry, and genetics to understand how nutrients affect the human body. Nutrition also looks at how people can use their diet to reduce their risk of disease, as well as what happens when they ingest too much or too little of a nutrient and how allergies emerge.