The gDNA sample that was isolated together with 12 other samples from other species were up for profiling. One of the target genes to be studied from these samples is the Nori gene. An optimized PCR protocol using a final concentration of 100 ng/µl 8DNA as template can sufficiently amplify the gene in a PCR with a 25-µl reaction volume. Copy and complete the table below: Initial [ ] Final [ ] Volume (µL) for Volume (uL)for (n+2)mastermix Component 1x PCR buffer 10x 1x MgCl2 50 mM 1.5 mM DNTPS 10 mM 0.2 mM each F. primer 5 μΜ 0.2 μΜ R. primer 5 μΜ 0.2 µM Таq pol 5U/ul 10/rxn 9DNA temp 50 ng/ul 20 ng/rxn sdH20 Total Vol. 25.0 µl

The gDNA sample that was isolated together with 12 other samples from other species were up for profiling. One of the target genes to be studied from these samples is the Nori gene. An optimized PCR protocol using a final concentration of 100 ng/µl 8DNA as template can sufficiently amplify the gene in a PCR with a 25-µl reaction volume. Copy and complete the table below: Initial [ ] Final [ ] Volume (µL) for Volume (uL)for (n+2)mastermix Component 1x PCR buffer 10x 1x MgCl2 50 mM 1.5 mM DNTPS 10 mM 0.2 mM each F. primer 5 μΜ 0.2 μΜ R. primer 5 μΜ 0.2 µM Таq pol 5U/ul 10/rxn 9DNA temp 50 ng/ul 20 ng/rxn sdH20 Total Vol. 25.0 µl

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
) Clearly and neatly diagram an image of the agarose gel indicating the fragments that would be generated from PCR of genomic DNA templates derived from an untransformed porcine cell line, a cell line in which there had been a monoallelic targeting event, and a cell line in which there had been a biallelic targeting event when using the primer pair H/B, if the PCR product(s) were digested with SmaI prior to electrophoresis. Illustrate the fragments and their sizes that would have been visualized on the gel. Note - now there has been digestion of the PCR product(s) with SmaI prior to electrophoresis
The exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested by HpaI alone, then another batch is fully digested by HindIII alone, and finally, a third batch is fully digested by both HpaI and HindIII together. The fragments resulting from each of the three digestions are placed in separate wells of an agarose gel, separated by gel electrophoresis, and stained by ethidium bromide. Draw the bands as they would appear on the gel.
Single stranded DNA fragment of M13 phage DNA shown was mixed with the following primers P1: AGTAG AATTGATGCC ACCTT; P2: TGT CTG GAA GTT TCA TTC CA and incubated in a thermal cycler in the presence of the four dNTPs and Taq DNA polymerase under the PCR conditions.AATGCTACTA CTATTAGTAG AATTGATGCC ACCTTTTCAG CTCGCGCCCC ATAGCTAAAC AGGTTATTGA CCATTTGCGA AATGTATCTA ATGGTCAAAC CGTTCGCAGA ATTGGGAATC AACTGTTACA TGGAATGAAA CTTCCAGACA What is the length of the PCR product? What is the final concentration of PCR product after 10 cycles if the starting template concentration was 1 nM?
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.
After digesting the DNA produced by PCR (generated using the primers mentioned in question 2 added for context below) and the pET-28a vector with restriction enzymes SacI and HindIII, what steps would be needed to obtain a pure culture of E. coli cells that contain the pET-28a-OXA-M290 plasmid (i.e., a culture which consists only of E. coli cells that contain this plasmid)? And, how could you confirm that the OXA-M290 gene was successfully cloned into the pET-28a vector without any mutations? [4 – 8 sentences suggested] Question 2 (Do not answer, just for context):The forward primer that will be designed is the primer that binds to the region of the OXA-M290 gene where the start codon is located, and the reverse primer is the primer that binds to the region of the gene where the stop codon is located. In order to clone the PCR product generated using these primers into pET-28a, extra nucleotides must be added to the 5' ends of the primers. These extra nucleotides will contain the…
A student is trying to add 15.0 ng of DNA template to a 20.0 µL PCR. The DNA template is at a concentration of 65.0 ng µL-1, and the student determines that a serial dilution is required because directly adding the DNA template would require a volume less than 1.00 µL. The student wants to prepare an intermediate solution at a concentration of 15.0 ng µL-1. If the DNA template stock will be mixed with 13.0 µL of ultrapure H2O, calculate the volume (in µL) of the DNA template required to prepare the intermediate solution.
The best combination of regeants for a typical PCR reacion would include the following concentration of reagents: a. 1x buffer, 1.5 mMm MgCl2, 0.5nM primers, 10mMdNTPs, 2units Taq, 1010 copies of template b. none of these answers c. 1x buffer, 1.5 mMm MgCl2, 0.5pM primers, 10mMdNTPs, 2units Taq, 105 copies of template d. 1x buffer, 1.5 mMm NH3 Cl2, 0.5pM primers, 10mMdNTPs, 2units Taq, 102 copies of template e. 1x buffer, 1.5 mMm KCL2 , 0.5nM primers, 10mMdNTPs, 2units Taq, 103copies of template thank you!!
Consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. If the given DNA sample was subjected to pyrosequencing, sketch the expected profile of the sequencing output. Assume that the sequential flooding of nucleotides follows the order G-C-A-T.
You wish to amplify a segment of DNA from a plasmid template by PCR with the use of the following primers: 5’-GGATCGATGCTCGCGA3' and 5' -AGGATCGGGTCGCGAG-3'. Despite repeated attempts, you fail to observe a PCR product of the expected length after electrophoresis on an agarose gel. Instead, you observe a bright smear on the gel with an approximate length of 25 to 30 base pairs. Explain these results.