The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA. What is the sequence of the RNA transcript specified by this part of the gene
Q: Aminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code.…
A: The protein synthesis involves the synthesis of the polypeptide chain which is catalyzed by several…
Q: A nonsense mutation is a substitution mutation that creates a chain-terminating codon in the mRNA…
A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…
Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…
A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…
Q: The residual end of a pre-mRNA transcript is digested by the following enzyme
A: Transcription is the process of formation of pre-mRNA (precursor mRNA) (heterogenous mRNA) from the…
Q: A certain gene in a bacterium codes for a polypeptide that is 400 amino acids long. How many…
A: Introduction Short strands of amino acids connected by peptide bonds are called peptidides.…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:
A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…
Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…
A:
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…
A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…
Q: About 98% of the E. coli genome codes for proteins, yet mRNA, the template for protein synthesis,…
A: In order for a gene to be converted into a functional protein, it has to undergo two processes…
Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…
A:
Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…
A: Transcription is the process by which the information contained in DNA is converted into a…
Q: What is RNA editing, how can it increase the number of proteins that can be formed from a single…
A: RNA editing also participated in the variations of proteomics sequence. In many types of cancers…
Q: Please describe the four-step process of the elongation during protein translation in bacteria.
A: Translation is the process of formation of proteins from mRNA with the help of ribosomes in the…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: The transcribed portion of a DNA sequence for a gene is shown below. Identify the MRNA sequence and…
A: The procedure of determining the order of the four nucleotide bases (adenine, thymine, cytosine, and…
Q: A nonsense mutation occurs in the AB sequence. What would be the most significant outcome of this?
A: Metabolic pathways- Metabolic pathway is a linked series of chemical reactions occurring within a…
Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…
A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…
Q: About 98% of the E. coli genome codes for proteins, yet mRNA, the template for protein synthesis,…
A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…
Q: A _____________ is a purine-rich sequence in close proximity to AUG on a prokaryotic mRNA that binds…
A: The answer is Shine- Dalgarno sequence
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: NASA has identified a new microbe present on Mars and requests that you determine the genetic code…
A: Introduction RNA is an abbreviation for ribonucleic acid, a nucleic acid found in all living cells.…
Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: If a gene sequence contains two poly-A sites, the first one in the middle of the sequence and…
A: Introduction: DNA contain the genetic information that transfer from one generation to another. The…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…
A: A DNA sequence is transcribed to produce messenger RNA (mRNA) which is a link between DNA and…
Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…
A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: A DNA molecule is a double-helical structure.
Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…
A: The process of protein synthesis using the information in an organism's DNA is called central dogma…
Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…
A: Answer: Central dogma replication----> transcription -------> translational DNA-------->…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…
A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…
Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: What are the nucleotides of the mRNA from gene Z? (see the attached picture)
A: Transcription is the process of synthesis of mRNA from DNA. The DNA strand which acts as the…
Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?
A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…
Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp…
A: translation is the process by which cell make proteins from mRNA . THIS process takes place in the…
Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -...…
A: The mRNA (messenger ribonucleic acid) is a messenger molecule produced through the process of…
Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…
A: The central dogma of life involves three major steps that include: DNA replication: This is the…
Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…
A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…
Q: Eukaryotic mRNA has a significantly longer half life than its prokaryotic counterpart. How is this…
A:
Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…
A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…
Q: Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other…
A: Transposing elements or the transposons are also known as the jumping genes. A transposable elements…
Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…
A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…
Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…
A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: Transcription is a process through which the double stranded DNA transcribes itself into a single…
Q: What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA…
A: The transcription of an mRNA encoding a 100-kDa protein by E. coli polymerase is known as…
Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation…
A: The start codon for eukaryotes is methionine. There are different initiation codons for different…
Q: Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid…
A: DNA => Transcription => mRNA => Translation => Protein. Given DNA sequence: 5' ATG CTT…
The gene encoding the E. coli enzyme enolase begins with the sequence ATGTCCAAAATCGTA.
What is the sequence of the RNA transcript specified by this part of the gene?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
- The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the messenger RNA sequence when Gene F is transcribed?The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
- If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?Hetero Nuclear RNA or hnRNA is the unmodified transcript. What process cuts out pieces of this RNA molecule? What is the name of the regions that are cut out?