Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.

Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.

Name: Which of the following represents the sequence of an RNA transcript fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid sequences that have been left blank. DNA______ ______ ______ ______ ______ ______ ______ ______ ______ mRNA A U G A C U A G C U G G G G G U A U U A C U U U U A G AA______ ______ ______ ______ ______ ______ ______ ______ ______
Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING: a.Complementary Strand: b. Direct Transcript: c. Transcript for Translation: d.Translated Amino Acid Sequence:
What would the amino acid sequence be for the following DNA Transcript? 5’AAGCCATTTAAAGGC 3’ 3’ TTCGGTAAATTTCCG 5’ Phe Gly Lys Phe Pro Phe Leu Lys Phe Val Lys Phe Phe Lys Pro Lys Pro Phe Lys Gly More information is needed
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? 5'-TGACTAACTG-3' 3'-TGACTAACTG-5' 3'-CAGTTAGTCA-5' 3'-TGACTAACTG-5'
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCA
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’