The coding strand of a mutant gene A allele is shown below. On the space provided, type the translation product of mutant gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' ATGGCCTCTTGCAAAGGGTATAGTCGTTGA 3'

The coding strand of a mutant gene A allele is shown below. On the space provided, type the translation product of mutant gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' ATGGCCTCTTGCAAAGGGTATAGTCGTTGA 3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Related questions

Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…

A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: The DNA sequence within the transcription unit of a gene is shown below. Important sequences are…

A: Transcription is the process which is responsible for making mRNA from the DNA by the action of RNA…

Q: Consider the following chart: What type of mutation is this? DNA: TAC GCA TGG AAT MRNA: AUG CGU ACC…

A: By the translation process polypeptide chain is being synthesized from the mRNA sequence by the help…

Q: WILD-TYPE MC1R GENE (LIGHT COAT-COLOR PHENOTYPE) DNA GTG TAC GAA CGT mRNA Amino Acid

A: MC1R gene It provides instructions for making a protein called the melanocortin 1 receptor. This…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…

Q: Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown…

A: INTRODUCTION Single nucleotide polymorphism Single nucleotide polymorphism is the single nucleotide…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…

A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…

Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ If there are…

A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…

Q: The following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3'…

A: Transcription is the process by which the information in a strand of DNA is copied into a messenger…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA is converted into a…

Q: A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of…

A: Template DNA sequence - 5’-CGATTACTG-3’ After transcription the sequence - GCUAAUGAC Explanation -…

Q: The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1:…

A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Which of the following DNA strands, the top or bottom, would serve as a template for RNA…

A: Transcription is the process of making an RNA copy of a gene sequence. This RNA copy is called a…

Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts For rest of parts pls repost.

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutations are the spontaneous and heritable changes in genome that occur either during DNA…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: What type of mutation is depicted by the following sequences (shown as mRNA)?Wild type ....5′…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: A mutation is a heritable change in the Deoxyribose Nucleic Acid (DNA) grouping of a life form. The…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…

Q: In the table below, there are four versions of gene A, one of which is normal, and the other three…

A: Mutations are sudden heritable changes that change gene expression. These changes in gene expression…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: Which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: Examine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR…

A: Despite of immense growth in science and technology of sequencing of RNA and DNA, it was challenging…

Q: The restriction enzyme Haelll has the recognition sequence below and cuts between the G and bases.…

A: restriction enzymes are the specific endonucleases that have a specific site within the DNA sequence…

Q: What is the complementarity rule that governs the synthesis of an RNA molecule during transcription?…

A: Complementarity is a property according to which two DNA or RNA strands bind with each other or new…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

No explanation needed

The coding strand of a mutant
gene A allele is shown below.
On the space provided, type
the translation product of
mutant gene A (use three-
letter abbreviation for the
amino acids; use - to indicate
a peptide bond).
5' ATGGCCTCTTGCAAAGGGTATAGTCGTTGA 3'

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Based on the given description, determine which mutation is being referred to A single base substitution such as UCC --> UGC a. silent b. insertion c. deletion d. transversion e. nonsense f. transition
A double mutant produced by uneven crossing-over contains two single nucleotide mutations that result in frame shifts and are separated by about 20 base pairs. The first is an insertion, while the second is a deletion. The amino acid sequences of the wildtype and mutant polypeptide in this region of the protein are as follows: Wildtype: Lys – Lys – Tyr – His – Gln – Trp – Thr – Cys – AsnDouble Mutant: Lys – Gln – Ile – Pro – Pro – Val – Asp – Met – Asn a) What are the original and double mutant mRNA sequences. You may find it useful to use the conventional symbols Y for pyrimidine, R for purine, N for any nucleotide, and H for A,C, or T. 2. b) Which nucleotide was inserted? 3. c) Which nucleotide was deleted?
Given the sequence of triplet codons: 5′-TAC AAA ATA CAG CGG-3′, write out one of each: transition; transversion; silent; missense; nonsense; frameshift mutations;
Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
Consider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGA
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
A small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine base
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?
-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG