The net energy requirement for translation of a 4 amino acid long polypeptide chain in terms of ATP will be (consider from the point of tRNA charging to the release of the polypeptide chain) O 18 O 17 20 19
Q: 1. Create a summary chart with the following headings: Macromolecule; Indicator; Positive Result…
A: Introduction: Lipids are biological macromolecules that are soluble in nonpolar solvents and…
Q: What's your next step to characterize this enzyme?
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They contain an…
Q: What effect is seen on a Lineweaver-Burke graph when a competitive inhibitor is added to an…
A: Competitive inhibition is an enzyme inhibition process where an inhibitor molecule (similar to the…
Q: In the tertiary structure of a protein, glutamine can interact with O valine; hydrophobic…
A: Proteins are bio molecules with vast diversity in their structure. They exhibit four levels of…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone that regulates blood glucose in levels in the body. It decreases the…
Q: What is the function of the alcohol in the extraction of DNA? What is the property/characteristics…
A: DNA extraction involves different steps which include, the breaking of cells to open and…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…
Q: 3. From a cell's point-of-view, which one or more of the following is/are the most effective (and…
A: The chemical equilibrium in a chemical reaction is reached when both the concentration of reactants…
Q: Protein folding can be described as an equilbrium between an unfolded state (U) and the folded…
A: Change in Standard Gibbs free energy (∆G0') is the change in Gibbs free energy (∆G) at equilibrium.…
Q: explain what coupled transcription-translation is, and why it occurs in prokaryotes but not…
A: According to the central dogma of molecular biology, the process of gene expression involves two…
Q: 1. The enzyme you are studying uses the substrate pictured at right. An inhibitor box in the freezer…
A: Enzyme inhibition is when a inhibitor bind to the enzyme at the active site or another site, which…
Q: a- Name the figure which shows the Co-translational translocation. A or B b -list the molecules…
A: The protein that are destined for secretion, the membrane proteins and the lysosomal proteins are…
Q: An ion exchange resin prefers calcium over magnesium, indicated by Xcalcium = 0.6 and Ymagnesium =…
A: An ion-exchange resin or ion-exchange polymer is a insoluble resin or polymer that acts as a matrix…
Q: In an experiment to determine the degree of saturation in 0.43 g of an unknown lipid, the following…
A: The fatty acids in triglycerides can have one or more double bonds in the hydrocarbon chain. Fatty…
Q: Identify the major and minor grooves in the DNA molecule PDB ID 141D. In addition, one end of a…
A: DNA is two strands of polynucleotide linked to each other in an antiparallel direction by hydrogen…
Q: Show how the addition of a competitive inhibitor would affect the reaction velocity and…
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. They contain an…
Q: What are the repurposing drugs used for treating parskinson disease?
A: Introduction: Parkinson's disease is a degenerative brain disorder that was first described by…
Q: For the following scenarios, determine whether the molecules in the scenario are moving by simple…
A: Biological membranes are structures that surround the cell or organelles and act as barriers. An…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: Triose phosphate isomerase In a key reaction of glycolysis, dihydroxyacetone phosphate (DHAP) is…
A: Given Values: ∆G°=7.5 kJ/mol or 7500 J/molT = 37°C or 310 KR = 8.314
Q: Choose the five correct labels for the figure Enzyme Active site Substrate binds at the enzyme…
A: Introduction Enzyme is a biocatalyst. Enzyme binds with the substrate to form enzyme substrate…
Q: Clathrin coat features and activities it participated include Its protein chains, triskelion,…
A: Transport mechanism of macromolecules across the plasma membrane is classified as endocytosis and…
Q: Which of the following, found within the interior of cytosolic proteins, is the most dominant…
A: Introduction Protein is the most abundant macromolecule of our body. Protein performs many functions…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Two dimensional (2D) polyacrylamide gel electrophoresis (2D PAGE) is a more powerful technique than…
Q: Which of the following amino acids has a side chain that can interact with the side chain of F…
A: The structure of the proteins is stabilized by the various covalent and non-covalent interactions.…
Q: explain and analyse each gene mutaition in the CIN, MSI, CIMP pathways and what are the causes of…
A: Colorectal cancers develops via an ordered series of events that initiates with the transformation…
Q: Shown below is a theoretical titration curve of histidine (amino acid). Use the provided titration…
A: Histidine is a basic amino acid with an alpha-carboxylic group, an alpha-amino group, and a…
Q: The proton-motive force is a measure of the potential energy generated across the mitochondrial…
A: The electron transport chain (ETC) is a chain of electron carriers present in the inner…
Q: The main stages of catabolism of biomolecules: proteins, carbohydrates and lipids.
A: Catabolism is the degradative pathway. It deals with the breakdown of complex molecules into simpler…
Q: 1. Deduce the primary structure of this polypeptide. 2. Why would cyanogen bromide not be a good…
A: a) Given the molecular weight of the peptide is 4000Average MW of an amino acid is 110 Da. So, the…
Q: 50. Express each of the following as a per- centage strength: (a) 1:1500 (b) 1:10,000 (c) 1:250 50.…
A: The Percent solutions can be in the form of weight/volume percentage, volume/volume percentage.…
Q: A 75 kg person doing light work requires about 3000 kcal of food energy per day, 40% of which is…
A: ATP is a form of chemical energy which is stored in its high energy phosphate bonds form. ATP…
Q: Identify if SN1, SN2 and so forth. Catabolism of triacylglycerols- beta-oxidation pathway…
A: SN1 and SN2 are common reactions in organic chemistry. SN1 is a two step reaction i.e., substitution…
Q: During protein synthesis, which step does NOT require energy? dissociation of the 70S ribosome after…
A: The process of gene expression involves two steps: transcription and translation. Translation is the…
Q: A formula for an antifungal shampoo con- tains 2% w/v ketoconazole. How many grams of ketoconazole…
A: Percent weight/volume is the amount of solute dissolved in 100ml of the solution.
Q: Which of the choices are types of posttranslational modifications a newly synth choices that apply.…
A: Posttranslational modifications are the amino acid side chain modification in some proteins…
Q: Label the lipophilic and hydrophilic region of each lipid molecule below. H₂C CH₂ H₂C-Ne H₂C H₂C. HO…
A: Lipids are integral component of the cell membrane. Their structure consists of a backbone made up…
Q: Test I. MULTIPLE CHOICE: Read the statement carefully. use CAPITAL letters. 1. It refers to the…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: How to calculate percentages of arginine 's side chain have positively charge at PH=7
A: INTRODUCTION: Arginine : It is an amino acid with the chemical formula CN(CH2)3CHCO2H. Its molecule…
Q: 3. 1,3-bisphosphglycerate has a high energy bond that can be used to phosphorylate ADP to make ATP…
A: Delta G or the standard free energy of a reaction indicates the tendency of a reaction to move…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: If the concentration of solutes in the fluid surrounding the cell is less than the cell's cytoplasm…
A: Osmosis is the movement of water across the semipermeable membrane driven by the difference in…
Q: Inhibiting the reverse transcriptase of HIV is a common method for treating HIV infections. a) The…
A: HIV is an RNA virus which has reverse transcriptase enzyme that can convert the RNA to DNA.
Q: What is the role of ribose in Central Dogma of Molecular Biology?
A: The information stored in the DNA flows to RNA and is then used in the synthesis of proteins. This…
Q: Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c)…
A: Peptides are composed of amino acids. Amino acids are biomolecules with an alpha carbon bonded to an…
Q: Insulin deficiency (occurrence/factors) factors affecting insulin levels including biological,…
A: The hormone insulin is in charge of permitting blood glucose to enter cells, giving them the energy…
Q: ENERGY vum Intermediate folding states Folded protein ww CONFIGURATION Figure 1: The Thermodynamics…
A: The proteins are constituted of twenty naturally occurring amino acids that are connected via…
Q: List the classification of fatty acids based on their chemical structures, as well as their…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Ph.D Fernando, Harvard Professor of Genetic Epidemiology, knows a thing or two about Twins. He must…
A: S-adenosyl-methionine: It is a typical cosubstrate used in amino-propylation, transsulfuration,…
Correct answer asap
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA formation.From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
- Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.In the serine protease triad, the proximity of an aspartatecarboxylate group to the imidazole group of histidine raisesthe latter’s pKa. Explain.Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.What is the role of ATP(CTP): tRNA nucleotidyletransferase?The following polynucleotide was synthesized and used as a template forpeptide synthesis in a cell-free system from E. coli. …AUAUAUAUAUAUAU…What polypeptide would you expect to be produced? What informationwould this give you about the code?
- For the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.Treating a solution of ribonuclease with 2-mercaptoethanol and urea denatures the enzyme. If the 2-mercaptoethanol is removed, followed by the removal of urea, the ability of the enzyme solution to hydrolyse RNA is reduced by about 99%. What is the most plausible explanation for this observation? a. All of the RNase molecules have about 1% of their usual activity, due to changes to the organisation of disulphide bonds b. Random formation of disulphide bonds mean about 1% of the RNase molecules are 100% active whereas 99% have no activity c. Deprotonation of histidine in the active site of the enzyme means that only about 1% of the enzyme molecules are active d. Deprotonation of histidine in the active site of the enzyme means that all of the enzyme molecules have 1% of their usual activityHbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.