explain and analyse each gene mutaition  in the CIN, MSI, CIMP pathways and what are the causes of these mutations in regards to adenocarcinoma tumours colorectal cancer.  Provide detailed analysis with examples

Q: (pmol) (a-32P) GMP INCORPORATED N 111 (a) (b) (c) 20 5 (min) 2.6 10 The image above shows an…

A: In eukaryotes the RNA Polymerase II is involved in the synthesis of mRNA. The RNA polymerase and…

Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…

A: A sphingosine , stearic acid and D-galactose would condense to form a sphingolipid. Sphingolipids…

Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…

A: Phosphofructokinase-1 (PFK-1) is a rate limiting enzyme of the glycolytic pathway. PFK-1 catalyzes…

Q: The structure shown is an example of a type of macromolecule (carbohydrate, lipid, protein, or…

A: The biological macromolecules that constitute a cell are proteins, nucleic acids, lipids and…

Q: Energy balance of the tricarboxylic acid cycle.

A: Tricarboxylic acid is also called as Krebs cycle, citric acid cycle, or TCA cycle. It involves the…

Q: Exergonic and endergonic biochemical reactions; the role of ATP and other macroergic substances in…

A: INTRODUCTION :   ATP - Adenosine triphosphate, it is the main energy currency or units, which is…

Q: At a substrate concentration that is much greater than the KM for the reaction, which statement is…

A: The velocity of an enzyme catalyzed reaction is given by: V=Vmax×SKM+SWhere,V= velocity of the…

Q: Specificity is defined as: A. False positive rate of a test. B. True negative rate of a test. C.…

A: Introduction There are  two kinds of tests used to assess people’s health, diagnostic tests and…

Q: F.28.   How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change

A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…

Q: E mitochondria Question #: 25 While developing new inhibitors we came up with new compound, a…

A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…

Q: b) Why might the compound shown below act as a transition state analog of phosphoglucose isomerase?…

A: Nitrogen containing transition state analogues are used to inhibit the isomerization reaction of…

Q: Describe the biological functions of lipids. What factorscan affect the transition temperature (Tm)…

A: Lipid is a biomolecule which is soluble only in nonpolar solvents. They are hydrocarbons which…

Q: OH i ACP Suppose that a "snapshot" of FA synthase was taken and the above (drawn) intermediate…

A: The given reaction is from fatty acid biosynthesis that occurs in the cytoplasm. Fatty acid…

Q: Match the following type of vesicles to the direction of transport of materials the vesicles do.…

A: In a cell, transport can be of different types: Endocytosis- Something goes out of cell by…

Q: Which of the following amino acids is generally absent from an a-helix? tryptophan serine isoleucine…

A: The alpha helix is secondary structure of protein in which the amino acid chain is arranged in a…

Q: Which of the following shows the structure of aspartic acid at pH 11? a H₂N. ОН ОН b H₂N ОН с H₂N ОН…

A: Aspartic acid (Asp or D); ionic form is known as aspartate, is an α-amino acid that is used for the…

Q: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same…

A: The genetic information is encoded in the sequence of DNA that is the genetic material. The Sanger…

Q: ESPIRATION - What is the purpose of cellular respiration? Where is cellular respiration performed…

A: Cellular respiration is the process of oxidizing nutrients like glucose to carbon dioxide and water.…

Q: What technique seperates proteins based on their ionic charge?

A: Proteins are high molecular weight polymers of amino acid residues, linked via a peptide bond. Amino…

Q: Glutamine is an amino acid that has -CH₂-CH₂-CO-NH₂ as its R group. The R group of the amino acid…

A: There are hundreds of different amino acids however only 20 different amino acids participate in…

Q: In the enolase reaction, the Lys 345 and Glu 211 residues participate in the reaction to convert…

A: Enolase is an enzyme which catalyzes the conversion of 2-phosphoglycerate to phosphoenolpyruvate.…

Q: Describe two different ways in which glucose oxidase is regulated. These mechanisms of regulation do…

A: Glucose oxidase: It is an oxidoreductase that catalyzes the conversion of glucose to hydrogen…

Q: 3. DNA: TACGGGCCTATACGCTACTAC TCATGGATCGG mRNA: Codon: Anitcodon: Amino Acids:

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: A formula for an antifungal shampoo con- tains 2% w/v ketoconazole. How many grams of ketoconazole…

A: Percent weight/volume is the amount of solute dissolved in 100ml of the solution.

Q: Identify the enzyme involved in this reaction from the Pentose Phosphate Pathway. NADP+ OH -H #V₂ H.…

A: In animal tissues, glucose has two possible fates: be oxidised into carbon dioxide and water by…

Q: Which statement is false for transition-state analog enzyme inhibitors? They fit the active site…

A: Transition state analogues are used as enzyme inhibitors. They bind competitively to the active site…

Q: Choose the five correct labels for the figure Enzyme Active site Substrate binds at the enzyme…

A: Introduction Enzyme is a biocatalyst. Enzyme binds with the substrate to form enzyme substrate…

Q: A.Provide the name for the D-monosaccharide “1”  in the above image. You may ignore the alpha  or…

A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…

Q: Which one of the following is found at the 5' end of eukaryotic mRNA?

A: Transcription is the process by which the genetic information stored in the DNA is copied onto a…

Q: The Hb Yakima variation is caused by the mutation D99H, which results in a shift in oxygen binding…

A: Hemoglobin binds to oxygen and it appears in two state. The T state (tensed) and R state (relaxed).…

Q: xplain the indirect effect that allosteric effectors have on pyruvate dehydrogenase activity through…

A: The pyruvate dehydrogenase complex acts a a connection between glycolysis, the tricarboxylic acid…

Q: The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide…

A: Introduction Protein is the most abundant macromolecule in our body. proteins are made up of carbon,…

Q: Select the chemical consequences that could contribute to DNA instability at AP sites. fewer…

A: AP sites are apuraniya sites that are created through the hydrolysis of N glycosyl bond between…

Q: 5. In the early days of protein biochemistry, these proteins were described using "operational…

A: Operational definition is applicable to many things in our everyday life. It is most popularly used…

Q: A certain amount of white solid was dissolved in enough water and gives a colorless solution.  A…

A: Carbohydrate: Also known as saccharides are often composed of monosaccharides, which are simple…

Q: Which of the following contains the largest number of r groups? Which contains sulfur? Please…

A: Amino acids are basic subunits of proteins/peptides. The alpha carbon of amino acids contains amine…

Q: Recall that vmax is achieved only at high substrate concentrations. Based on your answers to…

A: Competitive inhibitors of enzymes resemble one of the substrates of an enzyme.

Q: What is acid-base homeostasis?

A: Homeostasis is the ability of an organism to regulate its internal environment in varying external…

Q: Based on the amino acids present in the segments between the breakers, what do you predict the…

A: A protein's function depends on its structure. There are four levels of protein structure: primary,…

Q: (b) To the right is a diagram of the chemical groups in carboxymethyl-cellulose and DEAE-cellulose…

A: We are given the list and quantity of amino acid residues on the iso-1 cytochrome c and iso-2…

Q: Which of the following activities are present in the endomembrane system organelles? I.…

A: Endomembrane system organelles are the connected and coordinated pathway of membrane bound…

Q: A 100 mL of 0.1 M amino acid at pH 1.0, whose pKa for the carboxyl group is less than the pKa of the…

A: The amino acids carry different ionizable groups. The ionic form of the amino acids depends upon the…

Q: explain what coupled transcription-translation is, and why it occurs in prokaryotes but not…

A: According to the central dogma of molecular biology, the process of gene expression involves two…

Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…

A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…

Q: How to calculate percentages of arginine have positively charge at PH=7

A: pH is the measure of H+ ion concentration ( denoted by [H+]) in the solution. High pH means low H+…

Q: Increased ROS levels are a hallmark for Alzheimer's Disease. This is accurately described by all but…

A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…

Q: he following is a coenzyme or cofactor involved in enzymatic reaction. identify the biochemical role…

A: A coenzyme is an organic non-protein compound that binds with an enzyme and assists in enzyme…

Q: Inhibiting the reverse transcriptase of HIV is a common method for treating HIV infections. a) The…

A: HIV is an RNA virus which has reverse transcriptase enzyme that can convert the RNA to DNA.

Q: 13. Linear regression analysis was performed for the calibration standard data set based on this…

A: Concentration of any unknown sample can be found out from a standard curve. The standard curve is…

Q: KINETIC CONSTANT No Na2HPO4 25mM Na2HPO4 50mM Na2HPO4 Vmax nmol p-NP. Min- 20.3252 14.30615 17.30104…

A: Active site is the site where a substrate molecule binds with an enzyme. The binding between a…

Cancer Therapy