The process in which recipient bacterial cells acquire genes from cell-to-cell contact with other cells is called O Transposition Vaccination O Ligation Transduction O Conjugation O Transformation O Translation
Q: What will you find at the center of a clear plaque?
A: Plaques is opaque field of bacterial cultures which are infected by a virus or bacteriophage.
Q: The process by which one bacterial cell transfers DNA to another is:
A: Conjugation is a process of gene/DNA transfer between two bacterial cell that occurs when physical…
Q: Within prokaryotic organisms,. takes up DNA released by a donor cell that was lysed. is the process…
A: Horizontal gene transfer is a process of genetic recombination or sexual reproduction in prokaryotic…
Q: MRSA are resistant to because they have a O beta-lactam antibiotics including methicillin; mutant…
A: Methicillin-resistant Staphylococcus aureus (MRSA) infection is caused by a type of staph bacteria…
Q: A genetic sequence that can move from one location to an-other within a cell is known as a:(a)…
A: The genome comprises of the coding and non-coding sequences, in which the coding sequences are…
Q: The PCR technique requires a DNA polymerase from an organism that can endure high heat, such as…
A: PCR is referred to as polymerase chain reaction. It was discovered by a biochemist Kary Mullis. It…
Q: Which of the following gene transfer mechanisms is occurred by cell-to-cell contact? Lütfen birini…
A: Gene transfer is the insertion of unrelated genetic information in the form of DNA into other cells.…
Q: Transfer of F factor via bacterial conjugation uses a molecular mechanism related to: a.…
A: Bacterial conjugation may be defined as a process of gene transfer, horizontally, via pilus. The…
Q: Actinomycin D is an inhibitor ofa) Transcriptionb) Translationc) Replicationd) None
A: Actinomycin D, an antitumor drug composed of a heterocyclic chromophore and two cyclic pentapeptide…
Q: Choose the false statement: O Penicillin is a ß lactam which inhibits bacterial growth by inhibiting…
A: An antimicrobial is an agent that kills microorganisms or stops their growth. In this questions, we…
Q: two viruses infect the same cell. This results in the production of new viruses that contain genetic…
A: Infection refers to the entry of microorganisms into a host body followed by multiplication of the…
Q: The process of transferring DNA from one bacterium to another through a bacteriophage is called O…
A: Bacteriophage are obligate intracellular viruses that infect bacteria. Phage is surrounded by a…
Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…
A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…
Q: Polymerase chain reaction is commonly used in the laboratory for a) reverse transcription Ob) DNA…
A: In biological and medical research centers, The polymerase chain reaction (PCR) is a frequent…
Q: In the CRISPR system of bacteria, the spacer is a(n). A) O bacterial gene B) O bacterial enzyme C) O…
A:
Q: I the following statements about genetic exchange in bacteria is NOT true? a Plasmids do not have to…
A: Most bacteria are haploid organisms means carrying only one copy of each gene per cell which usually…
Q: OTPDI Ə g TITM d. The viral DNA will be rodioactive e. The viral proteins will be radioactive. 48.…
A: Introduction :- Transfer RNA is an adapter molecule made up of RNA with a length of 76 to 90…
Q: Pair the appropriate item with its purpose in the production of insulin a DNA containing the gene…
A:
Q: Some virulent bacteria become avirulent, or at least much less virulent, when a bacteriophage is…
A: Virulence is the ability of an organism to infect a host and result in a disease.
Q: When pieces of DNA that were not originally from a bacterial cell get integrated into its…
A: Introduction :- Bacteria are prokaryotic organisms . They do not have a well defined nucleus and…
Q: Which of the following stages is related with transformation process? I. formation cell to cell…
A: Gene transfer refers to the process by which genetic information from one organism is passed to…
Q: RNA polymerase synthesis in a 5-3 direction O Gene is switched ON O Gene is switched OFF O Does NOT…
A: Transcription is the process of synthesis of an RNA molecule from the template strand of the DNA…
Q: What do the results of Hershey and Chase's experiment show?* DNA is composed of a double helix. O…
A: Hershey and chase were the two scientist which performed experiment on the genetic material. They…
Q: "Knocking out" a gene with CRISPR-Cas9 leads to which of the following? O disruption of a gene O…
A: CRISPR-Cas9 is a unique technology that helps geneticists and researchers to edit a particular part…
Q: Which of the three methods of DNA transfer can occur between a bacterium and a plant? O…
A: Bacteria are microscopic organisms which belong to prokaryote because these are unicellular…
Q: Conjugation between bacteria is an example of: O sexual reproduction O asexual reproduction O a…
A: Conjugation between bacteria is an example of: • horizontal transfer
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: Bacteriophages can recognize the host cell by: O a. Binding of a viral protein to a receptor on the…
A: Note: We’ll answer the first question since the exact one wasn’t specified. Please submit a new…
Q: HIV is a retrovirus that has a few essential enzymes. One enzyme is O glycoproteins which are…
A: 2.) protease which aids in the attachment of the enveloped HIV onto body cells.
Q: The process by which point mutations cause slight changes in the spike proteins hemagglutinin and…
A: Mutations are any changes in the nucleotide sequence in genetic material like DNA and rna .
Q: Which of the following genetic mechanism isn't used by bacteria in the transference of genetic…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: Which one of the following is NOT an acquired resistance mechanism exhibited by bacteria to protect…
A: Introduction Small, single-celled organisms are known as bacteria. Nearly all areas of the world…
Q: The direct manipulation of genes is called O genetic engineering O DNA sequencing nucleic acid…
A: Gene can be defined as a unit of heredity.It is a segment of DNA(nucleotide sequence)that may…
Q: The function of CRISPR gene cluster in Streptococcus pyogenes is to Select one or more: O a. destroy…
A: CRISPR-Cas9 is a genome-editing mechanism that evolved organically in bacteria. CRISPR arrays are…
Q: The process of introduction of foreign DNA into an animal cell is calleda) Transversionb)…
A: The introduction of foreign DNA into host cell can be done by two major ways : (a) Indirect gene…
Q: The different strains of a bacterial species All of the answers are correct. can participate in…
A: Answer : The correct answer would be All of the answers are correct.
Q: The process in which recipient bacterial cells acquire genes from cell-to-cell contact with other…
A: Gene transfer is the process of insertion of unrelated DNA into cells. There are three mechanisms of…
Q: Which step(s) occur in the lysogenic replication cycle of temperate phage but does not occur in ytic…
A: A lytic cycle is a virulent form of life cycle found in the phage virus and the lysogenic cycle is a…
Q: The main enzymes commonly used in genetic engineering are: O restriction endonuclease and ligase O…
A: Genetic engineering is the process of altering an organism's genetic makeup using recombinant DNA…
Q: Why are there so many serotypes of the same bacterial parent strain? O Mutability O Genetics All…
A: Serotype A group of same species having distinct surface antigen receptors.
Q: The following proteins are involved in direct repair mechanisms except O Ada enzyme O Translesion…
A: Direct DNA repair mechanism The DNA is prone to mutations by various external factors. These results…
Q: A bacterial cell must have in order to transfer portions of its chromosome to another cell. O an F…
A: Bacteria are microscopic organisms that come in a variety of shapes and sizes. They can take the…
Q: In _____________, a bacteriophage may accidentally package random bacterial DNA and move it into a…
A: The horizontal gene transfer is the mechanism by which the DNA of one bacterium is transferred into…
Q: Escherichia coli O157:H7 can cause serious food- borne illness. This strain of E. coli has acquired…
A:
Q: DNA of bacterium Cell wall of bacterium replicate all of the genetic instructions found in humans O…
A: The process shown in the above diagram is known as Recombinant DNA technology. This recombinant DNA…
Q: When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a O…
A: The mutation is considered as the process during which nucleotide sequence is altered as a result…
Q: During DNA replication a point mutation occurred in the bacterial genome and is now being repaired.…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: In bacteria, acquisition of an F prime fâctór could fesult in the foHlation 8f ny, what ole diploid…
A: Bacterial cells contain one single circular chromosome. Hence bacteria are haploid by nature.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The process of introduction of foreign DNA into an animal cell is calleda) Transversionb) Conversionc) Inversiond) TransfectionChain-termination is a type of ______________a) Sequencingb) Vector generationc) Antibiotic productiond) Gene manipulation. When a virus mistakenly picks up a segment of host bacterial DNA, packages it into a viral particle, then transfers it to a new bacterial host cell, this transfer of DNA is properly called: transduction transformation conjugation transversion transition
- A binding site for RNA polymerase is called a ________. a. gene c. codon b. promoter d. proteinThe regulation of most bacterial genes occurs at the level of (a) transcription (b) translation (c) replication (d) posttranslation (e) postreplicationEnergy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
- The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.Antibiotics and Protein Synthesis Antibiotics are molecules produced by microorganisms as defense mechanisms. The most effective antibiotics work by interfering with essential biochemical or reproductive processes. Many antibiotics block or disrupt one or more stages in protein synthesis. Some of these are mentioned here. Tetracyclines are a family of chemically related compounds used to treat several types of bacterial infections. Tetracyclines interfere with the initiation of translation. The tetracycline molecule attaches to the small ribosomal subunit and prevents binding of the tRNA anticodon during initiation. Both eukaryotic and prokaryotic ribosomes are sensitive to the action of tetracycline, but this antibiotic cannot pass through the plasma membrane of eukaryotic cells. Because tetracycline can enter bacterial cells to inhibit protein synthesis, it will stop bacterial growth, helping the immune system fight the infection. Streptomycin is used in hospitals to treat serious bacterial infections. It binds to the small ribosomal subunit but does not prevent initiation or elongation; however, it does affect the efficiency of protein synthesis. Binding of streptomycin changes the way mRNA codons interact with the tRNA. As a result, incorrect amino acids are incorporated into the growing polypeptide chain, producing nonfunctional proteins. In addition, streptomycin causes the ribosome to randomly fall off the mRNA, preventing the synthesis of complete proteins. Puromycin is not used clinically but has played an important role in studying the mechanism of protein synthesis in the research laboratory. The puromycin molecule is the same size and shape as a tRNA/amino acid complex. When puromycin enters the ribosome, it can be incorporated into a growing polypeptide chain, stopping further synthesis because no peptide bond can be formed between puromycin and an amino acid, causing the shortened polypeptide to fall off the ribosome. Chloramphenicol was one of the first broadspectrum antibiotics introduced. Eukaryotic cells are resistant to its actions, and it was widely used to treat bacterial infections. However, its use is limited to external applications and serious infections. Chloramphenicol destroys cells in the bone marrow, the source of all blood cells. In bacteria, this antibiotic binds to the large ribosomal subunit and inhibits the formation of peptide bonds. Another antibiotic, erythromycin, also binds to the large ribosomal subunit and inhibits the movement of ribosomes along the mRNA. Almost every step of protein synthesis can be inhibited by one antibiotic or another. Work on designing new synthetic antibiotics to fight infections is based on our knowledge of how the nucleotide sequence of mRNA is converted into the amino acid sequence of a protein. Questions Why are antibiotics ineffective in treating the common cold and other virus infections?Reverse transcriptase assembles an ________ on an _______ template. a. mRNA; DNA c. DNA; ribosome b. cDNA; mRNA d. protein; mRNA
- Which of the following is a sequence of DNA where transcription is initiated? a. Kozak sequence. b. TBP c. Sigma Factor d. Promoter. e. AAUAAIn _____________, a bacteriophage may accidentally package random bacterial DNA and move it into a new recipient bacterial cell. Select one: a.conjugation b.transduction c.transcription d.transformation e.replicationThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
