2_53392678751...material, separate from the DNA inthe nucleus, and can make copies* .of themselvesthe lysosomes and peroxisomes.the endoplasmic reticulum.the mitochondria.the ribosomes.نقطة واحدة* :The range of the blood pH is7.0 to 7.507.30 to 7.407.40 to 7.537.35 to 7.45نقطة واحدةThe . . are the rarest form ofwhite blood cells and are involved in>

Blood consists of plasma (55% ) and blood corpuscles such as RBC , WBC and platelets (45%).Process…

Answered: :The range of the blood pH is

Science

Biology

:The range of the blood pH is

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 20QP: Indicate in which category, transcription or translation, each of the following functions belongs:...

See similar textbooks

Related questions

Q: Explain how sodium imbalances affect cardiac function.

A: Electrolytes are chemical substances that help to conduct electricity when dissolved in body fluids.…

Q: Please describe the blood hydrogen Carbonate buffer system and its importance.

A: Buffer is a solution which resist change in pH on adding little acid or base due to it's reserve…

Q: Explain the three major ways the body handles potentially developing acidosis.

A: Acidosis is a condition in which the body fluids contain too much acid. This condition occurs when…

Q: Explain Fluid volume deficit

A: The major composition of the human body is contributed by water, where the water content for adult…

Q: What is it called when blood pH is above what it should be?

A: pH is also known as the power of hydrogen. If a chemical has a lower pH it is said to be an acid,…

Q: Explain why acidosis may be fatal to an individual

A: Acidosis refers to the process that causes acidity of blood called acidemia. It is the decrease of…

Q: Decrease in bicarbonate concentration and decrease of blood pH below 7.35 metabolic acidosis…

A: Due to the fall in bicarbonate level, a condition called primary bicarbonate deficiency occurs. In…

Q: Blood pH is very carefully monitored... even a minor change causes significant physiological…

A: Imbalance in blood pH can cause acidosis or alkalosis.

Q: Describe what a fluid and electrolyte imbalance is and how this is important to the function of the…

A: Fluid and electrolyte balance test monitors the fluid homeostatic conditions on the body. It…

Q: Explain the actions of the three buffer systems of the body

A: The buffer systems functioning in blood plasma include plasma proteins, phosphate, and bicarbonate…

Q: Describe the acid-base balance of the blood, and how it is influenced by the respiratory system.

A: Blood is a carrier of all type of components in the body. Acids produced by the digestive system and…

Q: The buffer that is adjusted to control acid-base balanceis ________.a. plasma proteinb. hemoglobinc.…

A: A buffer is a solution that does not change its pH upon addition of an acid or a base. Also, if we…

Q: Differentiate Respiratory Acidosis from Metabolic Acidosis.

A: Acidosis is when the pH of your body fluids decreases.

Q: Explain the relationship between arterial PCO2 and pH values?

A: By measuring CO2 partial pressure in patients, we can recognize the intensity of ill. pCO2 is the…

Q: explain the role of glutamine system in adjusting the blood PH

A: Glutamine is an amino acid which is used in protein synthesis. Glutamine plays an important role in…

Q: Identify a signal the brain sends out after the nervous system sends the signal that pH has dropped.

A: The pH level of the blood is dependent on the amount of CO2 present in the blood. When the amount of…

Q: Explain how bicarbonate buffer system adjust blood ph

A: The physiological functioning of the body depends on acid and base concentration in the blood. The…

Q: a. Describe how excessive fluid is lost from the body duringstrenuous exercise on a very hot day.…

A: Electrolytes are mineral elements found in the body that play an important role in the execution of…

Q: What is the intake recommendations for water? Explain how alcohol, caffeine, and common medications…

A: Daily fluid intake (total water) is defined as the amount of water consumed from foods, plain…

Q: Graph the pH scale. Label the pH values that represent normal arterial and intracellular pH.

A: pH stands for the potential of hydrogen. It can be determined by the concentration of H+ ions…

Q: Blood Pressure at Rest/Room Temp Blood Pressure after 2 Minutes Exercise Blood Pressure after Cold…

A: Blood pressure is the pressure that blood exerts on the walls of blood vessels. It is explained in…

Q: Which do you think would have the most serious effect,and why—a 5 mEq/L increase in the plasma…

A: Electrolytes refer to the essential mineral that possesses many biological effects on the human…

Q: Which of the following is the most important bufferinside red blood cells?a. plasma proteinsb.…

A: Blood is a fluid that transports nutrients and oxygen to the cells and carries away carbon dioxide…

Q: State the percentage of body fluid, and explain the significance of an individual’s percentage…

A: The liquids present in the human body, which are categorized as intracellular and extracellular body…

Q: Explain the causes and effects of acid-base imbalances.

A: The pH levels of the extracellular fluids of the body which includes plasma and all other fluids…

Q: List the chemicals present in blood plasma

A: Blood is the body fluid that is composed of plasma and formed cell that circulates through the…

Q: Discuss the term dehydration

A: The major composition of the human body is contributed by water, where the water content for adult…

Q: Describe the function of the plasma proteins, electrolytes, gases, and regulatory substances.

A: More than 90 per cent of plasma is water. The remainder is mostly plasma proteins mainly albumin,…

Q: Explain the difference between Respiratory and Metabolic Acidosis.

A: Acidosis is an abnormal condition resulting from the accumulation of acid or from the depletion of…

Q: Describe the characteristics of blood.( contents, liquid vrs solid)

A: Blood is the fluid connective tissue present in the body of animals which is responsible for…

Q: Briefly justify the need to maintain an accurate blood acid-base balance.

A: oxygenation and deoxygenation is depended on the blood acid-base balance.

Q: What is buffer? What do you understand by term buffer capacity? How bicarbonate buffer works in the…

A: The pH value quantitatively measures the concentration of hydrogen ions (moles per liter) in an…

Q: explain how proteins used to minimize changes in blood pH.

A: Blood It is a body fluid flowing in blood vessels. It is red in color due to the presence of red…

Q: If a patient is experiencing third-spacing edema, the most likely lab value you would expect to see…

A: Excess fluid trapped in the body's tissues causes edema, or swelling. Although edema can affect any…

Q: List 3 health consequences of dehydration.

A: Dehydration happens when the body uses or loses more water than it takes in, and your body is unable…

Q: describe how fluids and electrolytes play a role in the maintenance and balance of the body

A: Sodium, calcium, potassium, chloride, phosphate, and magnesium are all important electrolytes that…

Q: Identify the various electrolytes, and give normal serum values for each.

A: Respiration is the process through which oxygen and carbon dioxide are exchanged between the…

Q: Explain the factors affecting plasma Mg

A: Magnesium is the 4th most common cation in the human body, it is an electrolyte required at a normal…

Q: 少 order; valproic acid o•075 Po Tio) per dose, give : use the label below for this question

A: Nursing care is the field of clinical practice of administration of drug ,patient counselling and…

Q: explain what is Thalassemia and what people with thalassemia should do?

A: Thalassemia is a blood disorder that is a genetically inherited disorder in which the body is…

Q: Explain the mechanisms involved in acid-base balance regulation for patients with chronic…

A: Acid-base homeostasis and pH regulation are important for maintaining normal physiology and cell…

Concept explainers

Homeostasis

Homeostasis is a self-regulatory process through which different biological systems maintain constant internal environmental conditions to compensate for environmental changes. In human physiology, it is a process of self-regulating internal, chemical, and physical conditions at an optimal level for survival. The stability through homeostasis can be attained through dynamic equilibrium, in which there is a continuous change until it reaches its systemic conditions.

Question

100%

2_53392678751...
material, separate from the DNA in
the nucleus, and can make copies
* .of themselves
the lysosomes and peroxisomes.
the endoplasmic reticulum.
the mitochondria.
the ribosomes.
نقطة واحدة
* :The range of the blood pH is
7.0 to 7.50
7.30 to 7.40
7.40 to 7.53
7.35 to 7.45
نقطة واحدة
The . . are the rarest form of
white blood cells and are involved in
>

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

When the dna is relaxed in the cell and is all stringy and evenly spread throughout the nucleus, we call it _________
I am in Microbiology and the question is how would I turn the following DNA strands to primary protein structure? a. TACCCGGTCAAGGACTCCATT b. TTACCGGCTCCGAATGACTTTT
In many genetic disorders, a lysosomal enzyme required to degrade a specific molecule is missing or defective. One example of these maladies, often referred to as lysosomal storage diseases, is Tay-Sachs disease. Afflicted individuals inherit a defective gene from each parent that codes for an enzyme that degrades a complex lipid molecule. Symptoms include severe mental retardation and death before the age of 5 years. What is the nature of the process that is destroying the patient's cells? (Hint: Synthesis of the lipid molecule continues at a normal rate.)
Which of the following phases is characterized by preparation for DNA synthesis? G0 G1 G2 S
Indicate in which category, transcription or translation, each of the following functions belongs: RNA poly-merase, ribosomes, nucleotides, tRNA, pre-mRNA, DNA, anticodon, amino acids.
Place the following structures in order from least to most complex organization: chromatin, nucleosome, DNA, chromosome DNA, nucleosome, chromatin, chromosome nucleosome, DNA, chromosome, chromatin DNA, chromatin, nucleosome, chromosome nucleosome, chromatin, DNA, chromosome
Arrange the following terms in order of increasing specialization: oligopotency, pleuripotency, unipotency, multipotency. multipotency, pleuripotency, oligopotency, unipotency pleuripotency, oligopotency, multipotency, unipotency oligopotency, pleuripotency, unipotency, multipotency pleuripotency, multipotency, oligopotency, unipotency
The family of a sixth-grade boy in Palo Alto, California, wasinformed by school administrators that he would have to transferout of his middle school because they believed his mutation ofthe CFTR gene, which does not produce any symptoms associatedwith cystic fibrosis, posed a risk to other students at the schoolwho have cystic fibrosis. After missing 11 days of school, a settlementwas reached to have the boy return to school. What ethicalproblems might you associate with this example?
Cystic Fibrosis is caused by which of the following? a. Replacement of three nucleotides with a new three nucleotide sequence b. Addition of three nucleotides c. Deletion of three nucleotides
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
Hello! Can you please explain why C is correct?
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’