The ribonucleotides C and G we're mixed together with C two times more abundant than G. The resulting RNAS we're translated in a cell free system. Give the amino acids and the relative percentages of each that would be found after the translation. Show all reasoning/calculations. Suppose that di-ribonucleotides (GC) were used to make RNA and then translated in vitro. What would the results be- explain all reasoning and explain how this information could be combined with the information in part A above to try to deduce the genetic code, assuming you didn't already know it

The ribonucleotides C and G we're mixed together with C two times more abundant than G. The resulting RNAS we're translated in a cell free system. Give the amino acids and the relative percentages of each that would be found after the translation. Show all reasoning/calculations. Suppose that di-ribonucleotides (GC) were used to make RNA and then translated in vitro. What would the results be- explain all reasoning and explain how this information could be combined with the information in part A above to try to deduce the genetic code, assuming you didn't already know it

Name: The ribonucleotides C and G we're mixedtogether with C two times more
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The ribonucleotides C and G we're mixedtogether with C two times more abundant thanG. The resulting RNAS we're translated in a cellfree system.Give the amino acids and the relativepercentages of each that would be found afterthe translation. Show all

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

Sickle-cell disease is caused by a so-called point mutation in the humanβ - globin gene. A point mutation is the result of a single base substitution inthe DNA encoding a gene. The sickle-cell mutation results in the substitutionof Val for Glu at position 6 in the β - globin protein.(a) Using the information in as shown, explain how a point mutationcould change a codon for Glu to a codon for Val.(b) Do you expect the pI for the sickle-cell β - globin to be higher or lowerthan the pI for wild-type β-globin ? Explain.
I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper discribtion what is happening in translation? In my texxbook it is explaing that mrna goesto rrna and rrna is the maker of the amino... or am I misunderstanding?
Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small ribosomal subunit from yeast (a unicellular eukaryote) beable to function in protein synthesis? Explain why orwhy not.
Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of proline (Pro)? 56.25% 6.25% 42.19% 18.75% 0%
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere along the RNA molecule. A synthetic RNA mole-cule has the sequence 5'-CGCUUACCACAUGUCGCGAAC-3'. How many reading frames are possible if this molecule is translated in vitro? How many reading frames are possible if this molecule is translated in vivo, in which translation starts with the codon AUG?
HbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.
The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.
Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of alanine (Ala)? 56.25% 6.25% 18.75% 0% 14%
On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′