If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the helix?    If the original strand serves as the template for transcription, what is the sequence on the new formed RNA strand

Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?

A: Transcription and translation are processes that a cell employs to create all of the proteins…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: Answer: Central Dogma : It is the complete process of replication of DNA,  transcription of DNA to…

Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…

A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Which type of RNA has the least amount of secondary structure? Explain

A: Ribonucleic acid (RNA) is considered an important biological macromolecule present in all cells to…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: If the DNA has a triplet code of CAG in one strand. What is the complementary triplet code in the…

A: Please post MCQ's as separate questions.

Q: What is the name of the nucleotide sequence that helps the 30S ribosomal (small) subunit find the…

A: Translation initiation proceeds through the capture of mRNA by the 30s ribosomal subunit in…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: How does discontinuous synthesis of the lagging strand keep up with continuous synthesis of the…

A: The DNA is always synthesized in the 5′ → 3′ directly with nucleoside triphosphates (NTPs) acting as…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: How many amino acids does the mRNA strand above code for?

A: 1. 4 amino acids does the above mRNA strand code have -

Q: Okazaki fragments are found on the _____________ strand.

A: DNA replication is the process by which DNA synthesise its copy prior to cell division. The two…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: A segment of one strand of a double-strandedDNA molecule has the sequence 5�-ACTTTCAGCGAT-3�. Whatis…

A: Transcription is the process of making an RNA copy of a gene sequence. As the nucleotide sequence of…

Q: The genetic code uses three bases to encode one amino acid. Why can't the code use only two bases to…

A: Genetic code is a triplet code that consist a set of three nucleotide bases, known as codons. Each…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: For a double stranded coding region DNA transcribed from left to right and whose top strand is…

A: There are two strands of DNA. One strand goes from 5' to 3' and the other strand goes from 3' to 5'.…

Q: Why could a codon not consist of only two bases?

A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: How many different single-nucleotide substitutions* (changing one nucleotide to another) in the DNA…

A: The single nucleotide substitutions that can occur to result in a non-sense mutations are -  i) CAA…

Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…

A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…

Q: how many polypeptide chain is the product of translation?

A: Amino acids are the building blocks of proteins, and each amino acid has a specific structure. The…

Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .

A: DNA is a double helical molecule, in which two complementary strands are held together with the help…

Q: What do you call the process of making chains of polypeptides out from RNA strand? Group of answer…

A: Nucleic acids are defined as the type of natural chemical compounds that play a major role in…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to…

A: During the process of transcription, the template strand or non-coding strand of DNA molecule gives…

Q: Why is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed…

A: Replication is considered as the process, during which DNA is replicated into DNA, which is after…

Q: Why are primers required in DNA replication but not in transcription?

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: The transcription enzyme that catalyzes  a strand of RNA from a DNA template is called what?

A: A gene is an area of DNA molecule or polymer of amino acid that encodes function. A chromosome…

Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…

A: DNA has two strands. One of the strands acts as the template strand for the synthesis of mRNA, while…

Q: How can you identify the start codon in the mRNA sequence ?

A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…

Q: Which type of RNA has the least amount of secondary structure?

A: RNA secondary structure of the single-stranded polynucleotides was mainly composed of a stem…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: Which process occurs with tRNA at the ribosomes? translation transcription…

A:

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: One strand of DNA has the base sequence as shown below. Complete the transcription and translation…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: What is the difference in DNA replicatoin on the leading strand versus the lagging strand?

A: DNA replication is a semi-discontinuous process as one strand is synthesized continuously whereas…

Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this,…

A: INTRODUCTION The RNA polymerase enzyme will read the DNA strand and make the mRNA molecule.

Q: In the sequences below, which is the coding strand and which is the template strand? A. 5-…

A: The strand of DNA which serves as the template for the mRNA synthesis during transcription is called…

Q: Why does DNA synthesis start with an RNA primer

A: By extending an RNA primer in the 5' to 3' direction, DNA polymerase begins to synthesise a new DNA…

Q: If there are 64 codons, how can there be fewer than 64 tRNA molecules?

A: An adapter molecule made of RNA, generally 76 to 90 nucleotides in length (in eukaryotes), that acts…

DNA and RNA

Deoxyribonucleic acid (DNA) is usually called the blueprint of life. Deoxyribose is a monosaccharide that has a key function in the synthesis of deoxyribonucleic acid. One less oxygen-containing hydroxyl group occurs in deoxyribose sugar. Nucleic acid, deoxyribonucleic acid, is one of the natural components. Deoxyribonucleic acid is a double-stranded molecule. Watson and Crick postulated the double-stranded model of the helix. A deoxyribonucleic acid is a molecular group that carries and transmits genetic information from parents to offspring. All eukaryotic and prokaryotic cells are involved.

DNA as the Genetic Material

DNA, or deoxyribonucleic acid, is a long polymeric nucleic acid molecule discovered in the late 1930s. It is a polymer; a long chain-like molecule made up of several monomers connected in a sequence. It possesses certain characteristics that qualify it as a genetic component. Certain organisms have different types of nucleic acids as their genetic material - DNA or RNA.

Genetics

The significant branch in science which involves the study of genes, gene variations, and the organism's heredity is known as genetics. It is also used to study the involvement of a gene or set of genes in the health of an individual and how it prevents several diseases in a human being. Thus, genetics also creates an understanding of various medical conditions.      

DNA Replication

The mechanism by which deoxyribonucleic acid (DNA) is capable of producing an exact copy of its own is defined as DNA replication. The DNA molecules utilize a semiconservative method for replication.