Q: Which statement is true of reverse transcriptase? a. It is a nucleic acid. b. It infects cells. c.…
A: Reverse transcription is a mechansim that is opposite to normal transcription in which the RNA…
Q: The 5' end of an mRNA corresponds to the __________ end of a protein. Question 27 options: A) 5'…
A: Biological molecules are those large molecules that are found in the cells of an organism which are…
Q: The molecule DNA is important to biological systems because a. it can be replicated. b. it…
A: DNA or Deoxyribonucleic acid is a complicated molecule that helps in transferring information in an…
Q: Chargaff's rule applies to: Group of answer choices A. only RNA B. both DNA and RNA C. only DNA…
A: INTRODUCTION chargaff's rule This rule state that the purine and pyrimidine bases of DNA of any…
Q: How many 3 base sequences are in the Genetic Code? 12 20 22 64
A: The DNA code is read by the cell in three-base groups. Each codon, or triplet of bases, determines…
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: A gene is a sequence of nucleotides in RNA or DNA that encodes for the synthesis of a gene product…
Q: RNA not exists in double stranded from as DNA. Why?
A: Nucleic acids constitute one of the four major macromolecules essential for life. RNA is a type of…
Q: What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c.…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: The law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the…
A: Translation is a process in which the messenger RNA or mRNA gets translated into protein. The…
Q: Why was the cold ethanol added to the soap and salt mixture?
A: DNA - is Deoxy Ribo Nucleic acid is a hereditary material which contains all the genetic information…
Q: Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino…
A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…
Q: In Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such…
A: DNA (deoxyribo nucleic acid) is genetic material of the cell. In case of eukaryotes, DNA is…
Q: The first genetic material on Earth was probably (a) DNA produced by reverse transcription. (b) DNA…
A: Genetic material contains genetic information and transmits it from generation to generation.…
Q: Queștion 1: The protein Collagen alpha-1 has 1671 amino acids. From start to stop codon, how long…
A:
Q: Which description best fits the definition of a messenger RNA? a An RNA that encodes for a protein b…
A: RNA is a single-stranded nucleic acid that aids in protein synthesis in our bodies.
Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…
A: The biochemical substance that is carried from the preceding generation to the succeeding generation…
Q: In DNA cloning, restriction enzymes are used to cut a DNA at specific sites b protein at specific…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends)…
A: The central dogma in both prokaryotic and eukaryotic cell comprises of replication of parent…
Q: Which scenario would NOT cause a change to the amino acid that is added to a polypeptide chain? a.…
A: m RNA codes for proteins. This process is called translation. mutation is change in the DNA…
Q: What do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA…
A: Sticky ends are also called as cohesive ends. These ends are produced in a DNA fragment when a…
Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48
A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.
Q: What is the maximum number of amino acids that can be encoded by a gene with 45 bases plus a stop…
A: The triplet code is comprised of three bases encoding for one amino acid. Thus, 15 amino acids can…
Q: Use the codon table shown above to help answer this question. What protein sequence would a cell…
A: The mRNA sequence is: 5' CCAUGCACCAAUAGAUAACCG 3' The Codon is read in triplet form.
Q: Define the following terms: a. wobble hypothesis b. aminoacyl-tRNA synthetase c. tRNA d. AUG…
A: Wobble hypothesis was proposed by scientist Crick mainly to explain the observed degeneracy in the…
Q: Use your genetic code (codon) table to answer the next two questions: What type of mutation would…
A: The answer to the above question is given below.
Q: a. Use the parent strand as a template to synthesize mRNA strand. Describe how the mRNA strand is…
A: Gene expression refers to the process that involves the formation of a functional product of a…
Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…
A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…
Q: Use the single strand of DNA below to answer the next two questions: 5' AGTTACCT 3' What is the base…
A: Nucleotides are the building blocks of nucleic acid. Nucleotide consists of three distinct…
Q: Explain the reasoning that established a sequence ofthree nucleotides (a triplet codon) as the basic…
A: The genetic code can be defined as a set of rules through which the living cells convert the…
Q: Illustrate the central dogma of life showing: a) codons b) Complementary strand of the master DNA c)…
A: The central dogma is the illustration in which DNA is converted into RNA and then into proteins.
Q: a. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and…
A: The given DNA, 5'- ATGTCGACGCGCAGGTGA - 3' 3' - TACAGCTGCGCGTCCACT - 5'
Q: _____________ are the linear sequences of nucleotides in an organism’s genetic information.
A: Cell possess genetic information inside the nucleus in the form of DNA as well as RNA, which act as…
Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…
A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…
Q: Predict what might happen if the DNA that coded for a protein contained the wrong base sequence.
A: The DNA sequence of a gene will determine the amino acid sequence of the resulting protein. It takes…
Q: DNA nucleic acids are held together by WEAK hydrogen bonds because...? A It was a mistake when being…
A: DNA is a double helix structure present in the nucleus of the eukaryotes.
Q: Use the diagram of a gene below to answer the question. The site of transcription initiation of the…
A: In the cytoplasm or endoplasmic reticulum, the process in which ribosomes synthesize proteins after…
Q: What is the sequence in the DNA that specifies the codon GCU? Answer with 5’ and 3’ ends labeled.
A: Codons Codons are the triplet form of mRNA which code for specific amino acid. In living organisms…
Q: Use the codon table shown above to help answer this question. Changing a UUG codon in mRNA to a UAG…
A: Proteins are made up of amino acids in a specific sequence and if mutation occur then the sequence…
Q: Which describes the role of primase during replication? a. It catalyzes the formation of…
A: An enzyme known as primase creates primers, which are short RNA sequences. Those primers act as the…
Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…
A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…
Q: Choose the combination of answers that most accurately completes the statement. Which of these…
A: The largest and broadest category of all groups in the classification of life is known as domain. At…
Q: Explain why the term " junk dna" may not be such an accurate description? (b) provide 1 similarity…
A: DNA is made up of introns and exons. Introns are the sequences that do not code for any functional…
Q: Biologists hypothesize that transposons eventually lose the ability to replicate and therefore…
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Predict what the results would be if mRNA were radioactively labeled instead of polypeptides. Give…
A: mRNA stands for messenger RNA. It is a single-stranded molecule that is complementary to one of the…
Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…
A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…
Q: For each example: a. fill in the complimentary DNA strand b. fill in the correct mRNA bases by…
A: Genetic code is the information stored in DNA in the form of its nucleotide sequence.
Q: Construct an explanation based on evidence for how the structure of DNA determines the structure of…
A: Proteins are the functional as well as structural units of cells. They are responsible for many…
| a. |
1
|
|
| b. |
3
|
|
| c. |
4
|
|
| d. |
20
|
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino acids. B. There are only 10 different amino acids in proteins. C. More than one codon for a specific amino acid. D. The genetic is misinterpreted to have U instead of T.What do genetic engineers use to create the “sticky ends” needed to splice two fragments of DNA together? a.) an amino acid sequence b.) DNA ligase c.) restriction enzymes d.) mRNAWhich helps prevent errors in DNA replication? A) Complementary base pairing reduce errors B) DNA ligase checks the DNA for errors C) DNA is located in the ribosomes D) Any base can pair with any other base
- Which event contradicts the central dogma of molecular biology? a. Poly-A polymerase enzymes process mRNA in the nucleus. b. Endonuclease enzymes splice out and repair damaged DNA. c. Scientists use reverse transcriptase enzymes to make DNA from RNA. d. Codons specifying amino acids are degenerate and universal.What is meant by the term DNA replication? a. synthesis of nucleotides b. cell division c. interpretation of the genetic code d. the exact copying of the DNA code into two new moleculesWhich is true of the lagging strand in DNA synthesis? a. It is built elongating towards the replication fork b. It is composed entirely of RNA c. It is built in the 3’ to 5’ direction d. It elongates in a series of segments, rather than continuously
- Why was the cold ethanol added to the soap and salt mixture? A To digest the cell walls B To dissolve the RNA C To emulsify lipids and remove large cellular debris D To precipitate the DNA E To denature the cytoplasmic proteinsWhat is the role of Proteinase K in DNA isolation? A. Inhibit enzymes B Catalyze breakdown of nuclei acids C Degrade proteins D Remove disultide bongs in proteinsa. Give the sequence of mRNA that would be transcribed off of the bottom strand and label its 5' and 3' ends. b. translate this RNA sequence in 1a into a protein sequence c. Give the sequence of mRNA that would be transcribed off of the top strand and label its 5' and 3' ends. d. Translate this RNA sequence in 1c into a protein sequence
- Choose the combination of answers that most accurately completes the statement.The function of ligase is to a. rejoin segments of DNA c. synthesize cDNA b. make longitudinal cuts in DNA d. break down ligamentsWhich step follows the assembly of new DNA strands by DNA polymerase? a.DNA ligase seals any gaps remaining between bases of new DNA. b.Primers base-pair with the exposed single DNA strands. c.Repair enzymes correct potential mutations in the DNA sequence. d.Enzymes unwind and separate the two strands of DNA.Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?