In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino acids and exon 3 has 3 amino acids. Remember start and stop codons! Highlight the introns and number the exons. Show the start codon and stop codon and highlight and number the exons. Remember all introns start with GT and end with AG. 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' (a) How many base pairs are in intron 1 and intron 2?

In this sequence there are two introns and three exons. Exon 1 has 3 amino acids, exon 2 has 4 amino acids and exon 3 has 3 amino acids. Remember start and stop codons! Highlight the introns and number the exons. Show the start codon and stop codon and highlight and number the exons. Remember all introns start with GT and end with AG. 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA CAG GCC GGA ATT TGA - 3' (a) How many base pairs are in intron 1 and intron 2?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
A frameshift mutation is caused by a: a. nucleotide substitution b. three-base insertion c. premature stop codon d. one-base insertion e. two-base deletion
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________
On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q") 5' UCAACUGCGAAUCUGGAAUAU 3'
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
From the picture provided, which colored option (exon variant) will give me: 1. start codon 2. Stop codon Im not sure how to identify with exon out of the 15 exon varients provided which one has the start codon and which has the stop I need to filter these colored options in order to find my start codon and stop codon
1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…