The two different types of obstacles that Pol II encounters during elongation, with a focus on the DNA-binding proteins

Q: A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has…

A: The pre-initiation complex forms at the core promoter to initiate the transcription of the…

Q: reduction in histone acetylation and reduced gene transcription. Given this information, which of…

A: Transcription is a highly controlled process and it requires the presence of enzymes polymerase and…

Q: three similarities and three differences between Long noncoding RNAs and Pseudogenes

A: A non-coding RNA is an RNA molecule that isn't converted into a protein. The DNA arrangement from…

Q: Promoters of the INS gene

A: The hormone insulin is required by the body to reduce the level of blood glucose. The pancreatic…

Q: HOW THE RECOMBINANT PROTEIN COULD BE EXPRESSED IN E. COLI 1. WAYS TO ENSURE THE PROTEIN IS ACTIVELY…

A: Traditional strategies for recombinant protein expression involve transfecting cells with a DNA…

Q: Responsible for relaxing supercoils in front of and behind transcription bubble.

A: The transmission of chromosomal DNA from generation to generation is crucial to cell propagation.…

Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…

A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…

Q: RNA induced gene silencing and the mechanism for sncRNAs (small noncoding RNA) in gene regulation…

A: RNA-induced gene silencing mechanisms govern the expression of the gene involved in tissue-specific…

Q: The addition or deletion of methyl and acetyl groups to regulate transcription Proteins that…

A: Answer. Transcription is a process of formation of transcript (RNA). It takes place by the usual…

Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…

A: The given statement is TRUE

Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…

A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…

Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…

A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: HOW THE RECOMBINANT PROTEIN COULD BE EXPRESSED IN E. COLI 1. STRATEGIES TO IMPROVE THE PROTEIN…

A: Protein expression is a feature of DNA Recombinant technology or genetic engineering. Protein…

Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…

A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…

Q: Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose…

A: Introduction Translation is the process through which a cell uses the genetic information relayed in…

Q: In transcription Rho-dependent termination in bacteriophage is more common than in bacteria. True…

A: Transcription is defined as the synthesis of mRNA from the template strand of DNA. The RNA…

Q: The three stages of transcription (initiation, elongation, and termination) – with a focus on how…

A: Transcription is a process of production of of RNA from the DNA. It is also called the expression of…

Q: Lactose operon and how does the system work

A: The functional unit of DNA (deoxyribonucleic acid) containing multiple genes, which are regulated…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: how Transposons Can Be Used asGene-Tagging Mutagens

A: Transposable elements (transposons) are jumping genes or DNA sequences that can move from one…

Q: The mechanism by which lactose controls the lac of A) O Catabolite repression B) O DNA polymerase C)…

A: Operons are studied to understand the regulation of gene expression. It is studied under the domain…

Q: why GC-rich DNA requires a higher temperature to denture or melt than AT-rich DNA and hypothesize as…

A: DNA is genetic material which contains all the information regarding function and development of an…

Q: how  PEV is used  to identify heterochromatin components

A: Heterochromatin is a type of chromatin. Chromatin is a structure of DNA wrapped around histone…

Q: How alternative splicing partially explainswhy the diversity of human proteins vastlyexceeds the…

A: Genes are the stretch of DNA and carry the information for a particular polypeptide chain.

Q: overlapping one another and amplifying themselves. Where do you expect to see bands of Primer dimer…

A: Primer dimers are commonly caused due to contamination of our DNA sample and can be observed as a…

Q: The possibility of a single locus in a DNA to code for different mRNAs.  If this is possible, what…

A: The possibility of a single locus in a DNA to code for different mRNAs.  If this is possible, what…

Q: The roles of core proteins and H1 histone proteins in DNA (Deoxyribonucleic acid) compaction.

A: The cell cycle is an important process that produces two offspring cells from a single parent cell.…

Q: The transcriptional complement of the DNA strand with the code 3’ TAA-CAT-GCT 5’ is

A: Introduction :- A region of DNA opens up during transcription. One strand, known as the template…

Q: Alternative RNA splicing

A: Alternate RNA Splicing   It is a mechanism during gene expression where a single gene code for…

Q: Matching Match each item with the correct statement below. Not all terms will be used a. 5' GTP cap…

A: Introduction Gene expression is the process through which information from a gene is utilised in the…

Q: Speculate as to why eukaryotes have either a) much more complex promoter and enhancer regions than…

A: In eukaryotes the process of transcription and translation are physically separated because the…

Q: To determine: The information gained about the function of WDR62 from the DNA sequence of the normal…

A: Introduction Genome:- The genome is the entire set of DNA instructions found in a cell,  In living…

Q: Heterochromatin is often associated with the of histones. Acetylation

A: Heterochromatin is a rich cytological substance found near the centromeres and telomeres of cells.…

Q: Unlike linker DNA and deproteinized DNA, DNA segments wrapped around histone cores are relatively…

A: Nuclease can digest nucleic acid.

Q: Which regulatory proteins binds to specific DNA sequences with high affinity and plays a…

A: Regulatory proteins are a family of specialized proteins that play a major role in the transcription…

Q: Four properties of DNA polymerases - specificity, thermostability, fidelity, and processivity - make…

A: DNA polymerases are the enzymes of DNA replication. DNA replication includes the production of new…

Q: Diagram of Eukaryotic transcription process.

A: Eukaryotic transcription is the complex process by which eukaryotic cells transcribe genetic…

Q: True or False? Eukaryotic genomes are organized into operons; each operon consists of a series of…

A: The operons are specialised portions of genetic material which have jobs of regulation and control…

Q: Chromatin remodeling is linked to epigenetics.  Explain how this works and indicate the driving…

A: Epigenetics is referred to as the study of phenotype changes that are inheritable and does not…

Q: The nucleosome assembly factor exclusively functions in DNA-dependent nucleosome assembly and binds…

A: Eukaryotic chromatin assembly factor 1 ( CAF -1) forms a protein complex that mediates the assembly…

Q: HOW THE RECOMBINANT PROTEIN COULD BE EXPRESSED IN E. COLI 1. FACTORS AFFECTING BACTERIAL EXPRESSION…

A:

Q: ACTIVITY 3: REGULATION OF TRANSCRIPTION From 5' to 3', what are the components of the lac operon,…

A: Lac operon is a cluster of genes which contains several structural and functional genes that helps…

Q: If the transposable element in Figure 15-14 were a DNAtransposon that had an intron in its…

A: Transposable elements are segments of DNA sequences that transpose or move from one site to another…

Q: in human genome if any example of mRNA that are translated from two possible region and are both…

A: Messenger Ribonucleic acids (mRNA): mRna transfers the information from DNA to the cell machinery…

Q: Tn10 has a ____________ structure and it is composed of a pair of insertion sequence elements (IS10)…

A: Tn10 is a transposable element that instead of replication uses the method of cut and paste. It is…

Q: What are the advantages of the DNA utilizing thymine in respect of a low error during replication of…

A: DNA replication is the process of making DNA from a DNA strand. It involves many enzymes and stages.…

Q: Why might there are more bands when DNA was mixed with both AA and Cu than in the controls?

A: Aspartic acid is antioxidant compound that in the presence of transition mettallic ion form free…

Plant sensory system

The plant sensory system is a sophisticated system that responds to environmental stimuli such as light,temperature, gravity, and touch. Research predicts that plant hormones and signaling mechanisms areresponsible for this regulation system in plants.