DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki fragment.
Q: The linking of the 5’ end of one Okazaki fragment with the 3’ end of an adjacent Okazaki fragment…
A: The DNA is the genetic material that is passed from one generation to the next generation. It is…
Q: Transposable elements are short segments of DNA, presentin ___________ locations, that move around…
A: Introduction Transposons are the short highly repeated DNA sequence present in heterochromatic…
Q: 8-oxo-G base in genomic DNA is often produced by and may be repaired by
A: 8-oxoguanine or 8-oxo-G is formed by the oxidation of a guanine base in DNA. It is widely…
Q: Why isn’t cDNA synthetic
A: INTRODUCTION Deoxyribonucleic Acid, or DNA, is a molecule that holds the instructions that an…
Q: The function of transposase isa. to recognize inverted repeats.b. to remove a TE from its original…
A: A gene is a specific sequence of nucleotides in RNA or DNA that is located usually on a chromosome.…
Q: What is the importance of the 3' to5' exonucleasevactivity of DNA polymerase
A: Enzymes serve as biological catalysts that fasten the rate of reaction by lowering the activation…
Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Which Strict Operating Requirements DNA Polymerase Has?
A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…
Q: A restriction enzyme digests DNA into fragments. Name the technique used to check the progression of…
A: DNA and RNA are nucleic acids that are found in living cells. Almost all living cells contain both…
Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…
A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…
Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…
A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: Using the plasmid map of pBCH2.0 calculate the length of the shortest DNA fragment if this plasmid…
A: DNA- is a deoxyribonucleic acid, made out of two polypeptides. Polypeptides are made from four…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: Restriction endonucleases are enzymes that cut DNA sequences at a specific site known as a…
Q: Which of the following sequences, when combined with itscomplement, would be clipped by a…
A: Restriction endonuclease is also known as restriction enzymes that are produced by the bacteria.…
Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…
A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…
Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......
A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…
A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.
Q: Chargaff determined the base composition of DNA from a variety ofdifferent sources. Explain how his…
A: DNA is a genetic element in all the prokaryotic and eukaryotic cells. DNA is double stranded helical…
Q: explain why DNA polymerase 3 and not dna polymerase 1 is responsible for replicating the bacterial…
A: Replication is a process where the genome is duplicated into it's exact copy. In bacteria,…
Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…
A: DNA is the genetic material present in all living cells. It carries information from one cell to…
Q: the target DNA
A: CRISPR: It stands for Clustered Regularly Interspaced Short Palindromic Repeats. These are the…
Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…
A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…
Q: The lagging strand is replicated with stretches of Okazaki fragments and its synthesis is considered…
A: Okazaki fragments are short sequences of DNA nucleotides that are synthesized and later linked…
Q: In eukaryotes, RNA primers are primarily removed by a. DNA polymerase I. b. DNA polymerase α. c.…
A: RNA stands for ribonucleic acid and is formed by the process of transcription. Generally, RNAs are…
Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…
A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…
Q: A DNA fragment with the following base sequence has some cytosine bases that are methylated…
A: The bisulfate sequencing is the treatment of DAN with bisulfite before the routine sequencing for…
Q: Primers are composed of and are made by the enzyme DNA; helicase DNA; primase O RNA; primase O RNA;…
A: A primer is a single strand of DNA that is short and acts as a starting point for the synthesis of a…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: State the characteristics that would be required for using a restriction endonuclease with human…
A: Restriction enzymes or restriction endonuclease are the enzyme naturally present in the bacteria…
Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…
A: To answer this question we should have knowledge of Biotechnology
Q: An experiment is performed with Primase, using a specific DNA template. In this experiment, you…
A: Radiolabeled nucleotides are used for the detection of specific nucleic acid sequences. For…
Q: A cDNA clone contains (a) introns (b) exons (c) anticodons (d) a and b (e) b and c
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: Some viruses, like SV40, are closed circular DNAS carrying nucleo- somes. If the SV40 virus is…
A: Topoisomerases are enzymes that participates in the overwinding or underwinding of DNA. The winding…
Q: Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each…
A: Restriction enzymes also called molecular scissors are originally a part of a bacterial defence…
Q: A 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6…
A: Restriction enzymes are also known as restriction endonucleases. These are the enzymes produced by…
Q: DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct…
A: The function of DNA polymerase is DNA replication ,that is, formation of daughter DNA from parent…
Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…
A: The invention of recombinant DNA technology was carried out by Herbert Boyer & Stanley & N.…
Q: Define about Alu family (the name is based on the presence of DNA sequences recognized by the…
A: Restriction enzymes are DNA cutting enzymes that are found in bacteria and as they cut within the…
Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…
A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…
Q: Which of the following are safe havens for transposableelement insertions?a. Intronsb. Exonsc. Other…
A: Transposing elements or the transposons are also known as the jumping genes. A transposable elements…
Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…
A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.
Q: Define and indicate the significance of (a) Okazaki fragments,(b) DNA ligase, and (c) primer RNA…
A: Introduction DNA replication is very crucial for the continuation of life as every new daughter…
Q: DNA polymerase III in bacteria is responsible for initiating DNA replication by adding nucleotides O…
A: Introduction:- Replication is a process by which a cell duplicates it's genetic material. There are…
Q: Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. EcoRI…
A: Introduction By cleaving the internal covalent bonds between nucleotides, endonucleases breaks down…
Q: What size DNA fragment would be released after very mild digestion of chromatin with micrococcal…
A: Introduction Micrococcal nuclease in as example of endo-exonuclease which is obtained from…
Step by step
Solved in 2 steps
- Hello, I have already asked for help with this question but whoever answered it copied the DNA Template strand down I correctly. Please see picture below and send correct Amino acid sequence. Thank you , gwenCan you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosen
- Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?Align your two superimposed fragments and look for a repeatI just need 3 and 4 to be answered! The restriction endonuclease BamHI recognizes the sequence GGATCC and cleaves between the Gs (in both strands). The enzyme Bgl II recognizes AGATCT and cuts between AG (in both strands). Justify your answers. 1. Draw the double stranded sequences of the DNA pieces shown above and indicate with an arrow the cutting points for each of the enzymes. Use different two colors for the two different sequences (one color for BamHI and another one for BglII). Do they generate blunt ends or sticky ends? 2. Draw the two sequences arising from each the cut (there will be four sequences). 3. Suppose that these pieces are part of longer sequences (so that they do not melt). Are the cut pieces complementary to each other? In other words, can you join the BglII and BamHI cut pieces with DNA ligase? 4. If the cleavage products can be joined together (i.e., a BamHI fragment joined to a Bgl II fragment), is the hybrid molecule cleavable by either nuclease?
- Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.Please answer fast A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is the non-underlined sequence between the exons. TAG, TAA, and TGA are stop codons. 5’-TAGTGTATTGACATGATAGAAGCACTCACTATATTCTGACGTGCGACTATGCGTGGGGTTAGGT ATTGTGCTGACTTTTCTCAGGTGGCCCGTATAGGCTAAGCTGCGCATCGCCGCTAGTCGCTCAGTTCCGC TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3’ 1) What are the first five deoxyribonucleotides of the DNA template strand read by RNA polymerase in the 3’ to 5’ direction? 3'-____ -5' 2) What are the first five ribonucleotides of the mRNA transcript of this gene ? 5'-____-3' 3) What are the first five ribonucleotides following exon 1 in the mature mRNA transcript? 5'-_____-3' 4) What is the 5' UTR of the mature mRNA transcript in ribonucleotides? 5'-_____-3' 5A) What are the first five ribonucleotides of the 3' UTR? 5'-_____-3' B) What are the last five ribonucleotides of the 3' UTR? 5'-______-3' 6) How many amino acids are…From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
- please answer remainnig questions too thanks. 1) Missense mutation 1)Deletion in Exon2, causing frameshift 1)Deletion in Exon 2, in frame g) large deletion covering Exons 2 and 3Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyNeed help, please. Please answer the following four questions to the image I attached. 1. You digest both plasmids with BamHI and SacI together (a double digest). What size fragments will result? Please indicate the sizes of the expected fragments in basepairs: The large fragment of pNUT is fragment A. This fragment is expected to be ____ bp. 2. The small fragment of pNUT is fragment B. This fragment is expected to be ____ bp. 3. The large fragment of pPOD is fragment C. This fragment is expected to be ____ bp. 4. The small fragment of pPOD is fragment D. This fragment is expected to be ____ bp.