The two strands of DNA in a double helix are ______________.

Q: Okazaki fragments are short DNA pieces that explain how

A:

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: What would happen if there was no methionine in the cell?

A: Amino acids are organic molecules that are the basic unit of proteins. Methionine is an essential…

Q: triphosphates (dNTPs) or nucleoside triphosphates (NTPS).

A: Viruses are not capable of translating the proteins,  thus they are dependent on host machinery for…

Q: What are the Aliphatic amino acids?

A: Amino acids are the building blocks of protein . They combine to form protein. Based on their side…

Q: biogenic amine

A: A biogenic amine is a compound which contains amine groups. amine group is nothing but having…

Q: Adenine always pairs with

A:

Q: why was glycerol added onto the total dna buffers?

A: The effect on DNA separation of adding glycerol to the running buffer was studied using linear…

Q: Question 37 The mRNA must contain the following to allow for initiation of protein synthesis in E.…

A: Translation is defined as the synthesis of protein from the mRNA. It takes place in the cytoplasm.

Q: Full explanation differentiate dna and rna

A: The biological macromolecules can be broadly classified a nucleic acids, proteins, carbohydrates and…

Q: D-Galactose.

A: ''Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: DNA  function

A: DNA or in full form Deoxyribonucleic acid is the molecule that carries the genetic information of…

Q: Question 9 5 pts 95 58 40 HS SH HS 8 M urea and 65 72 B-mercaptoethanol 65 26 Hs84 Hs HS HS 110-SH…

A: According to the Anfisen experiment of the protein folding, the disulfide bond can be disrupted by…

Q: What is polyacrylamide

A: Electrophoresis is the migration of charged particles under the influence of electric current.…

Q: DNA RNA PROTEIN

A: The central dogma is a molecular biology process that converts DNA to RNA and creates a functioning…

Q: Question 16 All of these can be gene products except A tRNA B proteins (c) dsDNA D) FRNA E) MRNA

A: A gene product is the biological substance produced by the expression of a gene, which might be RNA…

Q: Complementary DNA

A: DNA stands for deoxyribonucleic acid. It is a kind of genetic material.

Q: D-Erythrulose in cyclic form:

A: Erythrulose is chemically teterose carbohydrates.formula for erythrulose is C4H8O4. It is used in…

Q: QUESTION 51 DNA: O a. is a single strand of nucleotides. O b. transports amino acids during protein…

A: DNA is the genetic material in living organisms that is present in the nucleus, mitochondria and…

Q: Question 11 The A and B forms of DNA A are both left handed helix B are both right handed helices…

A: DNA is a dioxyribose nucleic acid. Which has made up of 2 polynucleotides strands coiled around each…

Q: Question 46 The degeneracy of the genetic code most often involves:     the third base of the codon…

A: Human body is equipped with an quick and efficient immune defense system that helps to protect the…

Q: How many nucleotides code for one amino acid

A: INTRODUCTION Amino acid These are molecules that combines to form protein.

Q: Why adenosine tri phosphate is called Biological coin

A: Introduction: As all tissues and all structured activity can be equated to the cellular level, the…

Q: Why uracil replaces thymine

A: DNA and RNA are nucleotides. They consists of a pentose sugar (deoxyribose in DNA and ribose in…

Q: In a DNA nucleotide, the______________ has four different variations.

A: Deoxyribonucleic acid, also abbreviated as DNA, is the principal informational macro molecule of…

Q: What are the Okazaki fragments?

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: QUESTION 23 The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded…

A: In DNA  base pairing rule is that adenine (A) pairs with thymidine (T), and cytosine (C) pairs with…

Q: Question 38 The 2 chains composing one double helix run in opposite directions; they are…

A: Yes its a true statement , the two strainds of the double stranded DNA runs in the antiparallel…

Q: Question 25 This molecule `NH A can form 3 hydrogen bonds in base pairing B is found in DNA only…

A: The genetic material stores information in the form of sequence of nucleotide.

Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…

A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…

Q: Sickle-cell disease is caused by a mutation.

A: The general shape of the RBC is round. Actual changes in the structure of gene and its amino acid…

Q: What does DNA STANDS FOR

A: DNA is made up of blocks of chemical compounds called nucleotides. These elements are made up of…

Q: Explain why 2-Deaxythymine exist in the lactam form rather than in the tautorneric lactim form. H3C.…

A: Introduction The heterocyclic bases possess the ability to undergo tautomeric interconversions that…

Q: Question 12 Repulsion between phosphate groups keeps the strands a uniform distance apart.

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…

Q: Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER DNA Sequence:…

A: Closer the DNA constitution of organisms closer are they in their protein content. One can determine…

Q: question 38 The constant region of each heavy chain determines the class of the heavy chain.…

A: Ans : True - The constant region of each heavy chain determines the class of the heavy chain.

Q: Lactose is a monomer composed of galactose and glucose.    true or false

A: Question - TRUE / FALSE  - Lactose is a monomer composed of galactose and glucose.

Q: MAB stands for what?

A: Introduction: The biosphere is the artificially enclosed area prepared to self-contain the plants…

Q: this structural formula represent: -COH

A: The structural formula is a graphic representation. It shows how the atoms of a compound are…

Q: The simplest monosaccharide.

A: Carbohydrates are polyhydroxy ketone or polyhydroxy aldehyde or compounds which produce them on…

Q: If DNA segments changes from GCATAG to GCATA, this is a:

A: Mutation is a sudden, stable, and variable change in the genome of an organism. It may be due to…

Q: Question 5 Name 2 differences in the structural features of DNA and RNA and indicate the relevance…

A: Nucleic acid is a biological macromolecule that is present in a cell and carries genetic…

Q: PKU is an abbreviation for what disorder? What are the symptoms of PKU? How can PKU be treated for a…

A: Phenylketonurina is a rare inherited disorder that causes an amino acid called phenylalanine to…

Q: Sequence changes in DNA are called ______________.

A: Evergy organism  DNA consists of the unique nucleotide sequence that carries the information a cell…

Q: . The DNA strand whose %T is 50%

A: DNA Deoxyribonucleic Acid (DNA) is the genetic material of many organisms including viruses,…

Q: DNA REPLICATION/REPAIR PROTEINS

A: DNA stands for deoxyribonucleic acid. DNA replication is a very important process in the life cycle…

Q: Question 19 Listen Aminoacyl-tRNA synthase recognizes their specific amino acid by and A ; they…

A: Aminoacyl tRNA synthase is also known as tRNA ligase.  It loads or charge the tRNA with specific…

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.