This question refers to the following table, which compares the percent sequence homology of four different parts (two introns and two exons) of a gene that is found in five different eukaryotic species. Each part is numbered to indicate its distance from the promoter (e.g., Intron I is the one closest to the promoter). The data reported for species A were obtained by comparing DNA from one member of species A to another member of species A. % Sequence Homology Species Intron I Exon I Intron VI Exon VI A 100 100 100 100 98 99 82 96 C 98 99 89 96 99 99 92 97 E 98 99 80 94 Which of these four gene parts should allow the construction of the most accurate phylogenetic tree, assuming that this is the only part of the gene that has acted as a reliable molecular clock? Intron VI Exon I Exon VI Intron I O O

This question refers to the following table, which compares the percent sequence homology of four different parts (two introns and two exons) of a gene that is found in five different eukaryotic species. Each part is numbered to indicate its distance from the promoter (e.g., Intron I is the one closest to the promoter). The data reported for species A were obtained by comparing DNA from one member of species A to another member of species A. % Sequence Homology Species Intron I Exon I Intron VI Exon VI A 100 100 100 100 98 99 82 96 C 98 99 89 96 99 99 92 97 E 98 99 80 94 Which of these four gene parts should allow the construction of the most accurate phylogenetic tree, assuming that this is the only part of the gene that has acted as a reliable molecular clock? Intron VI Exon I Exon VI Intron I O O

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.
The genomes of most multicellular eukaryotes encode~25,000 genes, yet their proteomes contain over 200,000proteins. Propose two processes that, taken together, account for this discrepancy
Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?
Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and D gene segments which undergo recombination to generate the final V region coding exon. Some of these have 12-nucleotide spacers between the heptamer and nonamer, and others have 23-nucleotide spacers. The reason recombination signal sequences come in these two forms is: To ensure the correct assembly of gene segments so that a VH recombines to a DH and not to another VH, for instance To ensure that the heptamer and nonamer are found on the same face of the DNA double helix To ensure that alpha, lambda, and heavy chains recombine within a locus and not between loci To ensure that alpha, lambda, and heavy chain gene segments do not undergo recombination with non-immunoglobulin genes To ensure that the RAG recombinase cuts the DNA between the last nucleotide of the heptamer and the coding sequence
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.
The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)
You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'
The following table lists 4 bacterial strains that are partial diploids for lac operon genes. Given the activity of beta-galactosidase measured for each strain in the absence (-lac) or presence (+lac) of lactose, complete the table by choosing the appropriate symbol (+, -, C, S) to indicate the allele of the gene or site missing from the table (blue numbers). strain A BC 5 C D 7 chromosome I O 1 2 4 1 [Select] 9 3 [Select] [Select] [Select] 9 [Select] + + Z + + 6 + I +5 + 10 plasmid O 3 + 7 C Z + 8 8 2 [Select] 4 [Select] 6 [Select] B-gal act. -lac +lac 0.002 0.003 0.002 0.058 0.063 0.121 0.059 0.062 Select] 1 ✔ [ Select] + is C S
The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URFs). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows:15 percent are lethal when knocked out.25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth).60 percent show no detectable mutant phenotype at all and resemble wild type.Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.
The sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.