The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that twomature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsiblefor producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided.Hint: This organism produces a poly-A tail of 120 nucleotides.99621208410227117Gene XE111E212ЕЗ13E4Exon (E)Intron (I)

Name: The figure below shows the introns and exons found in gene X. The siz
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that twomature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other

Exons are the coding sequences that is they code for a specific functional product either in the…

Science

Biology

The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found tha mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (1)

The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found tha mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (1)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU—3′
Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the above
Which of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…
. The human gene for ß2 lens crystallin has the components listed below. The numbers represent nucleotidepairs that make up the particular component. Assumefor simplicity that no alternative splicing is involved.5′ UTR 1741st exon 1191st intron 5322nd exon 3372nd intron 14313rd exon 2083rd intron 3804th exon 4444th intron 995th exon 5463′ UTR 715Answer the following questions about the ß2 lenscrystallin gene, primary transcript, and gene product.Questions asking where should be answered with oneof the 11 components from the list or with None.Assume poly-A tails contain 150 As.a. How large is the ß2 lens crystallin gene in bp (basepairs)?b. How large is the primary transcript for ß2 lenscrystallin in bases?c. How large is the mature mRNA for ß2 lens crystallin in bases?d. Where would you find the base pairs encoding theinitiation codon?e. Where would you find the base pairs encoding thestop codon?f. Where would you find the base pairs encoding the5′ cap?g. Where would you find the base…