Three bases on MRNA that translate into an amino acid are called:

Q: Messenger RNA is formed by translation of a gene on the DNA template strand.True or false?

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: The genetic code is defined as a series of _______________ in _______________.   (a) anticodons;…

A: The genetic code, anticodons, codons, mRNA, and tRNA are all involved in the expression of a gene. A…

Q: Describe how protein are created in translation. Step by step

A: The translation is the process of protein synthesis.

Q: Which of the following is not directly involved in translation?

A: Translation is the cycle where ribosomes present in the cytoplasm or endoplasmic reticulum blend…

Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…

A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…

Q: Which of the following is responsible for the ability of one gene to code for more than one type of…

A: During RNA Splicing: Introns -excised and exons - ligated together.

Q: Describe the synthesis and processing of mRNAs.

A: ANSWER;- mRNA is "courier" RNA. mRNA is synthesized in the core utilizing the nucleotide arrangement…

Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…

A:

Q: During transcription, what will the order of bases be in mRNA, if the base sequence of the coding…

A: ans is... CUAGCU

Q: The set of mRNAs present within a cell changes over time.Explain.

A: The conversion of a liquid into a gas is known as boiling or vaporization. The temperature at which…

Q: What two types of molecules are involved when a codon pairs with its anticodon?

A: Ans. Genetic code is a term used to identify the four bases of DNA, A, C, G, and TS, in a way that…

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: If a tRNA has an anticodon with the sequence 5′-CAG-3′, which amino acid does it carry? a. Aspartic…

A: An anticodon is the nitrogen base triplet present in the transfer RNA molecule and the codon is the…

Q: The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino…

A: Translation of messenger ribonucleic acid (mRNA) into amino acid begins at the 5' end and stops at…

Q: Which of the following are involved in transcription? O RNA polymerase DNA amino acids TRNA acetyl…

A: In translation mRNA, tRNA, rRNA, Amino acids, ribosome, acetyl transferase are required.

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: A substitution mutation that results in the formation of a stop codon and premature termination of…

A: Mutations are the alterations or the change that occur in the DNA. Mutagens, like ultraviolet…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus?  In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: Three bases (letters) on an MRNA are called and three bases (letters) on a tRNA are called

A: Messenger RNA is a single-stranded RNA molecule. It is formed from the DNA template during the…

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: An mRNA molecule codifies only one type of protein?

A: mRNA (messenger RNA) molecules are also known as transcripts that carry the coding sequences for the…

Q: The term translation refers to which of the following? a. DNA → RNA b. RNA → DNA c. proteins → RNA…

A: DNA is the double-helical structure, which carries all the genetic information of the cell, whereas…

Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…

A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…

Q: A point mutation that changes a codon specifying an amino acid into a stop codon is called a

A: Point mutations are those which substitutes one nucleotide (within) a codon into another. Due to…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: Which of the following RNAS is the product of transcription?

A: Transcription is the process of making an RNA copy of a gene sequence

Q: During the initiation of translation, the ribosome assembles on an mRNA strand with the start codon…

A: The process of polymerisation of amino acids from a polypeptide is known as translation. The…

Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…

A: Introduction  Gene expression can only occur when the Gene is transcribed into mRNA and then this…

Q: If the base sequence of a segment of a molecule of DNA is changed, will the base sequence of the…

A: The genes are segments of DNA that contain hereditary information. Some part of this gene is…

Q: List the four nucleotides found in mRNA.

A: Messenger RNA is a single stranded molecule made up of nucleotides. Each nucleotide is made up of a…

Q: Which of the following types of RNA carries the genetic information from DNA in the nucleus to the…

A: Since there are multiple questions in this particular question, I will answer the first one for you.…

Q: A mutation that changes a normal codon to a stop codon is called a

A: The mutation is a permanent alteration in the DNA sequence that makes up a gene, such that the…

Q: The structural portion of genes contains two distinct types of regions—exons and introns. Which…

A: Introns and exons are nucleotide sequences inside a gene. They both are distinct regions of the…

Q: Why don’t cells need one tRNA for each codon?

A: tRNA : Transfer RNA : It is a type of a molecule that helps decode mRNA sequence into protein.…

Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…

A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…

Q: The relaxation of base-paring rules between the TRNA and mRNA is termed as Answer:

A: Introduction: Ribonucleic acid or RNA is the type of nucleic acid that is mainly present in the…

Q: In mRNA, thymine is replaced by the nitrogenous base______

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: What characteristic of the genetic code explains why a substitution mutation in a codon contained…

A: Codons are sets of three nucleotides responsible for the detection by tRNA for the type of amino…

Q: A particular tRNA can recognize only one specific codon in an MRNA.

A: The given statement is TRUE

Q: Eukaryotic transcription and translation are similar in that both result in synthesis of

A: Answer: EUKARYOTIC = These are the organisms which have organelles present in the cell.

Q: Describe the steps of translation initiation,elongation, and termination.

A: Introduction:- The process of forming a polypeptide chain from mRNA codons is known as translation…