Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now wants to know what his real fur colour is...he's thinking maybe red or yellow. Help Jesse determine his fur colour using the gene below that codes for his fur colour. Assume that this entire piece of DNA is transcribed into RNA and that RNA is then processed by a ribosome. ACC G C G GTTTACTTTG C C C G A ATT GATGA a) After transcription, the code would read... b) After translation, the polypeptide sequence would read...

Jesse is a cat from an old cartoon. The show was only produced in black and white, and Jesse now wants to know what his real fur colour is...he's thinking maybe red or yellow. Help Jesse determine his fur colour using the gene below that codes for his fur colour. Assume that this entire piece of DNA is transcribed into RNA and that RNA is then processed by a ribosome. ACC G C G GTTTACTTTG C C C G A ATT GATGA a) After transcription, the code would read... b) After translation, the polypeptide sequence would read...

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
How would you make a copy of DNA from an mRNA transcript and what is this molecule called?
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What nitrogenous bases would be found on "the other DNA strand lying alongside of it?" b) Which nitrogenous bases would be found on the MRNA (Messenger RNA) transcribed from a DNA strand with the following nucleotide sequence: AAA/TTT/GGG/CCC?
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence?
DNA is the cellular repository of genetic information, andproteins are synthesized from RNA transcripts. Why don’tcells simply skip the transcription step and use DNA directlyin protein synthesis?
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands and what direction will the RNA polymerase travel to make the mRNA? Transcribe the DNA into mRNA (Include polarity)and translate the mRNA into a polypeptide chain (Include polarity)
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Define replication, transcription, and translation. In what part of the cell does each process occur?