True or False? The +1 transcription start site (+1 tss) occurs at the end of the 5' untranslated region (UTR) and is at the start codon. O True False
Q: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
A: 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the…
Q: RNA codon table 2nd position G 1st A 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Cys…
A: Three consecutive nitrogen base on mRNA is called genetic code which determine a specific amino…
Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…
A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…
Q: Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical…
A: Introduction 1. Hydrogen bonds are a type of attractive interaction between an electronegative atom…
Q: Some eukaryotic promoters contain an element positioned around nucleotide +1 called a…
A: The transcriptional initiator (Inr) for mammalian RNA polymerase II is a DNA sequence element that…
Q: Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in…
A: RNAi (RNA interference) is a method in which double-stranded RNA is used to suppress gene…
Q: True or False: 1. All functional transcripts have been initiated, elongated and terminated with…
A: False : post transcription events include splicing, capping, tailing. Initiation is the beginning of…
Q: TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of…
A: The nucleic acid polymer has nucleotide as its monomeric unit. Nucleotides are essential in the…
Q: A section of DNA has following sequence of nitrogenous bases: CGATTACAG. Which of the following…
A: Transcription is a process of copying a piece of DNA into RNA.
Q: Choose the correct option for following three mcqs 16.Termination codons differ from other codons…
A: Note: Please upload other questions separately. Answer: Introduction: A codon means an order of…
Q: 94 In the arrested state (7-14 nucleotides) of elongation, ( ) is required to reactivate…
A: In molecular biology, the central dogma explains a lot about the transcription and translation in…
Q: A mutation called base substitution mutation had been altered the sequence in a. eliminated the…
A: Base substitution is a type of mutation in which one nucleotide base is substituted by the other and…
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: G* is a base analog. It usually acts like A. But, when the right mood hits, it pairs up with A.…
A: In human DNA four types of nucleotide are present adenine (A) , guanine (G) , thymine (T) ,and…
Q: How many other codons apart from the one used could encode the last amino acid in this peptide (i.e.…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: True or False: 1.Functional proteins also undergo chemical modifications like the removal of the…
A: Chemical modification of functional proteins.
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Transcription -- Transcription is a process in which DNA sequence is copied to form an RNA molecule…
Q: True or False: When determining the transcription start site, there is a nucleotide position…
A: Question - True or False : When determining the transcription start site , there is a nucleotide…
Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…
A: Mutations are changes that occurs in nucleotide sequence of DNA.The types of mutation are:…
Q: Matching type. Match column A with column B. Your answer in column B should be matched with column…
A: Molecular biology has become the most recent tool added to the study of genetics. It provides…
Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…
A: There are many biomolecules present in an organism and each biomolecule has a specific role.…
Q: True or False? Chromatin remodeling involves addition or removal of chemical groups to histones,…
A: The dynamic change of chromatin architecture to give condensed genomic DNA access to regulatory…
Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…
A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…
Q: Exons are removed during mRNA splicing. O True O False
A: The statement is absolutely false .
Q: overlapping one another and amplifying themselves. Where do you expect to see bands of Primer dimer…
A: Primer dimers are commonly caused due to contamination of our DNA sample and can be observed as a…
Q: Yes or no? No explanation. rna polymerase are recruiting to start transcription but promoters…
A: Dear student, As per our guidelines we are supposed to answer only one question. Please repost the…
Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…
A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…
Q: Transcription Translation DNA MRNA Protein The central dogma of molecular biology states that…
A: Central dogma of Molecular Biology states that information runs unidirectionally from DNA to RNA…
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: a) The genetic code in unambigous that means many codons can code for the same amino acids. b)…
A: 1. The genetic code is UNAMBIGUOUS:- Means that each triplet specifies only a single amino acid.…
Q: Examining Figure 20-8, explain why the rate of evolutionat nonsynonymous sites is lower. Do you…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can occur as a result…
Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…
A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: True or False: 1. Amino acid chain elongates when the AA from the peptidyl binding site is added to…
A: The translation process is started by ribosomes. Ribosomes are made up of bigger and smaller…
Q: Leaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the…
A: mRNA or messenger RNA is the molecule synthesized during the process of transcription from the DNA…
Q: Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a…
A: A mutation is defined as the change in the sequence of DNA of a cell in organisms or viruses. These…
Q: The presence of a polyA tail in eukaryotic mRNA helps protect the mRNA from degradation. true/false
A: The poly-A tail is long chain consisting of adenine nucleotides which is added to mRNA molecule…
Q: 1. True about Isopeptide bond is: It makes protein resistant b. Bond is formed between carboxy…
A: Isopeptide bond , also known as atypical peptide bond or pseudopeptide bond , is formed between an…
Q: The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a…
A: Hi, Thanks For Your Question. Q2. Answer : The Maximum Score That A Sequence Can Have With This…
Q: During translation, each tRNA molecule must be activated in order to bind to the correct amino acid…
A: In molecular biology, translation is the cycle wherein ribosomes in the cytoplasm or endoplasmic…
Q: Do you think it matters which protein is mutated? Is one protein more important than another? How…
A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…
Q: Questión 15 The following statements best describes the RNA structure EXCEPT A it is usually single…
A: Answer : Option D is correct. - according to the question asked above, option (d) cannot describe…
Q: (True/False) There is no redundancy in enzymes that catalyze histone modifications, meaning that an…
A: NOTE- Since you have posted multiple questions, we will be solving the first two questions as…
Q: True or False. Rho-dependent termination of transcription in prokaryotes can take place upon the…
A: Transcription termination is the end process for the transcription of RNA and this process is of two…
Q: mutation each as Deletion, Insertion or Substitution AND as either , missense, silent or nonsense…
A: In this question, we have to identify the type of mutation in the given DNA sequence.
Q: 2. A reversion is a mutation that returns a mutant codon back to a codon that gives a wild-type…
A: Reversion mutation is one that causes such a change in the gene that does not cause change in…
Q: TATAA AUG UAA Only known regulatory region TSS Mutation C. 3 nucleotides Mutation B: 20 nucleotides…
A: Mutations are the changes in the DNA sequence that may or may not have an effect on gene function…
Q: True or False: In eukaryotes, some parts of the RNA sequence transcribed by RNA polymerase are cut…
A: Introduction: The production of proteins is a two-step procedure. A molecule of mRNA is generated on…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Prokaryotic cells lack a nucleus. Therefore, the genes in prokaryotic cells are: all expressed, all of the time transcribed and translated almost simultaneously transcriptionally controlled because translation begins before transcription ends b and c are both trueTrue or False? Eukaryotic genomes are organized into operons; each operon consists of a series of genes which code for enzymes involved in a metabolic pathway, under the transcriptional control of a single promoter sequence .What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)
- ANWER FAST NO NEED FOR LONG EXPLANATION 1. In the sugar-phosphate backbone of DNA, the phosphate group is located in the 3’ end while the deoxyribose is present in the 5’ end. Select one: True False 2. Not all missense mutations will lead to nonfunctional proteins. It all depends on where the substitution lies in the polypeptide chain and how it will affect protein folding and activity. Select one: True False 3.What component(s) is/are involved in transcription? a.Sigma factor b.RNA polymerase c.Promoter d.B and C e.All of the aboveTrue or False: 1. All functional transcripts have been initiated, elongated and terminated with post transcriptional processing. 2. When transcribing the missense strand the direction of growth is towards the 5’end of the template.True or False? LINE elements encode functional transposition protein and thus can move autonomously in the human genome. True or False? Target-primed reverse transcription can mobilize information through an RNA intermediate.
- Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of previously formed Okazaki fragments. 2. All tRNAs have the sequence -CCA at their 5’terminus. 3. Termination of translation does not require the hydrolysis of any high-energy phosphate bonds. 4. Assembly of a complete ribosome onto mRNA requires GTP hydrolysis.Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’
- 1. true or false a) Capping is the process of adding poly-guanido methyl in the mRNA. (true/false) b) In a nucleosome (histone-DNA structure), the histone is highly positively charged. (true/false) c) The presence of lactose in E.coli triggers the transcription of Lactose Operon.Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesisMutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?