In your own words Consider the following DNA coding strand:5' - ATGTACGGCGAATAA-3'a) Determine the sense strand.b) Demonstrate what the mature MRNA strand may look like. (Refer to theunderlined bases as exons.)c) Determine the polypeptide chain (as well as the MRNA sequence).Be sure to include 3' and 5' ends in your response where necessary.MRNA Codon/Amino Acid ChartFirst BaseSecond BaseThird BaseAGUCU¬UAU1FTyrosine (Tyr)UACJUUU1PhenylalanineUGU,FCysteine (Cys)UGC-UUC-(Phe)UCSerine (Ser)UCAUGA - StopUUA1FLeucine (Leu)UUGJUAATAUCG-StopUAGJUGG - Tryptophan (Trp)GCAU1Histidine (His)CACCUUTCCU1CGUTUCUCFLeucine (Leu)CUACGCProline (Pro)CCAFArginine (Arg)CGACAA1 GlutamineACAG (Glu)CGG-CUG-CCGJGAGUTFSerine (Ser)AGC-AUUTACU1AAUTU| AsparagineAACJ (Asn)AUC FIsoleucine (lle) ACCThreonine(Thr)AAUA-ACAAAA1AGA7AStart Methionine(Met)FLysine (Lys)AAG-FArginine (Arg)AGG-AUGACG-GGUUTGCUGAU,GGUTUAspartic AcidGACJ (Asp)GUCGCCGGCGFvaline (Val)FAlanine (Ala)Glycine (Gly)GUAGCAGAAJ Glutamic Acid GGAAGAGJ (Glu)GGG-GUG-GCG-G

Within the biological system, the flow of genetic information is explained as molecular biology's…

UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3' a) Determine the sense strand. b) Demonstrate what the mature mRNA strand may look like. (Refer to the underlined bases as exons.) c) Determine the polypeptide chain (as well as the mRNA sequence). Be sure to include 3' and 5' ends in your response where necessary. MRNA Codon/Amino Acid Chart First Base Second Base Third Base A UUU, Phenylalanine UCUT UAUT UGU U UUCJ (Phe) UGC- UC Serine (Ser) UCA U UGA - Stop A UUA FLeucine (Leu) UUG UAAT Stop UAGJ UCG UGG - Tryptophan (Trp) G CUUT CCU1 CGU1 CAUT "Histidine (His) CAC U CUC CGC FLeucine (Leu) CUA CC Proline (Pro) CCA FArginine (Arg) CGA CAA1 Glutamine A CUG- CCG- CAGJ (Glu) CGG- G AAU Asparagine AACJ (Asn) AUUT ACUT AGUT U FSerine (Ser) AGC- AUC FIsoleucine (lle) ACC Threonine A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A AUG Start Methionine (Met) ACG- GUUT GCU GAU1 GGUT U | Aspartic Acid GAC (Asp) GUC Fvaline (Val) GUA GCC FAlanine (Ala) GCA GGC Glycine (Gly) G GAA1 Glutamic Acid GGA GAG (Glu) A GUG- GCG- GGG-

UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3' a) Determine the sense strand. b) Demonstrate what the mature mRNA strand may look like. (Refer to the underlined bases as exons.) c) Determine the polypeptide chain (as well as the mRNA sequence). Be sure to include 3' and 5' ends in your response where necessary. MRNA Codon/Amino Acid Chart First Base Second Base Third Base A UUU, Phenylalanine UCUT UAUT UGU U UUCJ (Phe) UGC- UC Serine (Ser) UCA U UGA - Stop A UUA FLeucine (Leu) UUG UAAT Stop UAGJ UCG UGG - Tryptophan (Trp) G CUUT CCU1 CGU1 CAUT "Histidine (His) CAC U CUC CGC FLeucine (Leu) CUA CC Proline (Pro) CCA FArginine (Arg) CGA CAA1 Glutamine A CUG- CCG- CAGJ (Glu) CGG- G AAU Asparagine AACJ (Asn) AUUT ACUT AGUT U FSerine (Ser) AGC- AUC FIsoleucine (lle) ACC Threonine A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A AUG Start Methionine (Met) ACG- GUUT GCU GAU1 GGUT U | Aspartic Acid GAC (Asp) GUC Fvaline (Val) GUA GCC FAlanine (Ala) GCA GGC Glycine (Gly) G GAA1 Glutamic Acid GGA GAG (Glu) A GUG- GCG- GGG-

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’
For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Speciﬁes the order of amino acids in a protein, using a series of three-base codons, where different amino acids are speciﬁed by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Given the following mRNA sequence, what is the amino acid sequence of the polypeptide that will be produced in the cell? 5’ – CGAGGUAUGCCAACGUGCGUCUAAUCCCGA-3
If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is 3’ ATTGTACGG 5’, the mRNA sequence will be?
Which of the following are stages of translation? Select all that apply. ---A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. ---When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. ---As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. ---The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon. ---Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA.
If a strand of mRNA contains the sequence, UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?
How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?