Unneeded genes in an adult animal cell are permanently inactivated,making it impossible for most specialized cells to turn into any othercell type. How does this arrangement save energy inside a cell? Whydoes the ability to clone an adult mammal depend on techniques forreactivating these “dormant” genes?

Unneeded genes in an adult animal cell are permanently inactivated,making it impossible for most specialized cells to turn into any othercell type. How does this arrangement save energy inside a cell? Whydoes the ability to clone an adult mammal depend on techniques forreactivating these “dormant” genes?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 3QP

See similar textbooks

Similar questions

In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?
What major advantage does cloning mammalian genes frommRNA or using synthetic genes have over PCR amplification andcloning of the native gene?
. In yeast, you have sequenced a piece of wild-type DNAand it clearly contains a gene, but you do not know whatgene it is. Therefore, to investigate further, you wouldlike to find out its mutant phenotype. How would youuse the cloned wild-type gene to do so? Show your experimental steps clearly
You want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the protein typically localizes within mitochondria. How will you perform your gene cloning so that the protein is secreted from the cell, rather than localized within yeast mitochondria?
The search for the BRCA1 breast cancer gene discussed in this chapter was widely publicized in the media (for example, Newsweek, December 6, 1993). Describe the steps taken by Mary-Claire King and her colleagues to clone this gene. How long did this process take?
why does a clone of cells produceonly one type of G-6-PD enzyme? What would you expect to happen if a clone was derived from an early embryonic cell? Whydoes the initial sample of tissue produce both forms of G-6-PD?
For what reasons would gene therapy be more effective performed onembryos rather than fully developed animals?
Do a few cells created by therapeutic cloning of your own somatic cells constitute life? If these cells do constitute life, do they have the same rights as a human being conceived naturally? If it were possible, should someone be allowed to grow his or her own therapeutic clone into an adult?
Woolly mammoths have been extinct for about 4,000 years, but we often find their well-preserved remains in Siberian permafrost. Research groups are now planning to use SCNT to resurrect these huge elephant-like mammals. No mammoth eggs have been recovered yet, so elephant eggs would be used instead. An elephant would also be the surrogate mother for the resulting embryo. The researchers may try a modified SCNT technique used to clone a mouse that had been dead and frozen for 16 years. Ice crystals that form during freezing break up cell membranes, so cells from the frozen mouse were in bad shape. Their DNA was transferred into donor mouse eggs, and cells from the resulting embryos were fused with undifferentiated mouse cells. Four healthy clones were born from the hybrid embryos. What are some of the pros and cons of cloning an extinct animal?
By whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…
Some vectors used in cloning experiments contain bacterial promotersthat are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and express the gene in bacterial cells. These vectors are called expression vectors. If you wanted to express a eukaryotic protein in bacterial cells, would you clone genomic DNA or cDNA into the expression vector? Explain your choice.
If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?