If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?

If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 3QP

See similar textbooks

Similar questions

If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
Why was cDNA and not genomic DNA used in the commercial cloning of the human insulin gene?
Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?
In order to manufacture insulin for patients with diabetes, scientists create recombinant DNA by inserting a human insulin gene into bacterial DNA and have the bacteria produce human insulin. Based on what you have learned in this unit about gene expression, what must the scientists do to the DNA sequence of the human insulin gene BEFORE inserting it into the bacteria, in order to have them produce the same insulin sequence that humans would produce? Explain.
Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in immature red blood cells is a reliable indicator that more alpha hemoglobin protein will be made in those cells?
Cloning Genes Is a Multistep Process The following DNA sequence contains a six-base sequence that is a recognition and cutting site for a restriction enzyme. What is this sequence? Which enzyme will cut this sequence? (See Figure 13.5 for help.) 5 CCGAGGAAGCTTAC 3 3 GGCTCCTTCGAATG 5
Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not? How many more genes in the plasmid (besides the insulin cDNA insert) are need to determine which bacterial cells have been transformed and to determine which transformed bacterial cells have a plasmid with the cDNA insulin insert? What is needed in the plasmid with the cDNA insert besides the gene for insulin to actually cause the bacteria to express the insulin gene and produce the insulin protein?
You isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region of gene A, known to be methylated under certain circumstances. To determine which cell type has methylation in this region, you treat the DNA with sodium bisulfite, sequence the regions from both brain and heart cells, and compare to the untreated sequence, as shown below. Untreated: ATCCGGCGACG Brain: ATCCGGCGACG Heart: ATCTGGTGACG Given these results, which cell type would you expect to transcribe MORE "A" mRNA?
If we were to clone this gene directly from the nuclear DNA, bacteria would not be able to express the insulin protein. Explain why this is true
You isolate a mouse Tau-gene-containing DNA fragment from the chicken and hybridize it to the freshly-made and isolated hnRNA (primary transcript) from the nucleus of the mouse cells transcribed from the Tau gene (immediately after it was produced), allowing no time for processing of the hnRNA. Describe what you see when you look at the DNA/RNA hybrid molecule under the electron microscope.
In 1994, telomerase activity was discovered in human cancer cell lines. Although telomerase is not active in human somatic tissue, human somatic cells do contain the genes for telomerase proteins and telomerase RNA. Since inappropriate activation of telomerase may contribute to cancer, why do you think the genes coding for this enzyme have been maintained in the human genome throughout evolution? Are there any types of human body cells where telomerase activation would be advantageous or even necessary? Explain.
Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'