Use the table of the codons to answer the following question. Starting with the start codon, what is the sequence of the peptide th translated from the mRNA AGAUGAAAGACGCGCUAUUGUGACGU Arg Lys Thr Arg Tyr Cys Asp Arg Met Lys Asp Ala Leu Leu Asp Lys Gln Ala Ile Val Ser Cys
Q: Which of the following mechanisms ensure that the utilization of dietary nucleic acids is effected?…
A: Purine and pyrimidine biosynthesis occurs from the waste products of other metabolic pathways like…
Q: Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon…
A: Adenine, Guanine, Cytosine, and Thymine are the nitrogenous bases present in DNA. Adenine and…
Q: Based on the degree of saturation which lipid is a better choice to spread on food, butter or…
A: A lipid with a lesser degree of saturation is unharmful to health. Highly saturated lipids build up…
Q: I. ATP ACCOUNTING, Provide what is being asked for. Show all relevant calculations and summarize…
A: Fatty acid oxidation is the process in which long-chain fatty acids are converted into acetyl-CoA.…
Q: 2. The kinetics of an enzyme are measured as a function of substrate concentration in the presence…
A: The enzymes catalysts that facilitate biochemical reactions. The enzymes are inhibited in presence…
Q: A receptor, R, binds to its ligand, L, according to the binding curve shown below. If [R]= 30 mM at…
A: Kd is dissociation constant which is ligand concentration at half of the saturation of receptors or…
Q: Metabolite 3 The common name for metabolite 3 How does its structure differ from diazepam? -OH
A: Oxazepam, like the related 3-hydroxybenzodiazepine lorazepam. Oxazepam is thought to be less prone…
Q: 1.0 0 0.5 0 5 Ligand A Ligand B 10 15 20 25 Ligand Ligand D 40 45 50 55 60 30 35 [Ligand] (MM)
A: Kd is dissociation constant which is ligand concentration at half of saturation or at 0.5 theta…
Q: A GRK inhibitor would have what effect on GPCR inactivation in the presence of a GPCR agonist? (a)…
A: Agonists are substances which mimic the activity of a ligand. The activation of the GPCR triggers a…
Q: Glycolysis consists of three irreversible steps. Which of the following enzyme- catalyzed reaction…
A: Glycolysis is the first stage of cellular respiration during which glucose is converted to pyruvate…
Q: Which of the following statements is incorrect? The rigidity of a saturated fatty acid is…
A: The biological macromolecules can be classified as nucleic acids, proteins, lipids and…
Q: Modify isoleucine to show the predominant forms at pH 1, 7, and 13. Isoleucine has pK, values of 2.4…
A: Proteins are polymer of amino acids , and each of the amino acid residue is linked to its…
Q: d Question # 6. On the right is a schematic showing the structure of complex V (ATP Synthase). The…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: WASTE OF ALCOHOL DISTILLERY PLANT GIVE 2 WASTE WASTE WASTE WHEN MANUFACTURING ALCOHOL
A: Distillery plants are the ones that are widely used for the purpose of manufacturing alcohol. This…
Q: Fatty acid synthesis requires the activation of acetyl CoA to malonyl CoA. However, its condensation…
A: Fatty acids are broken down to acetyl Co-A and the precursor for the fatty acid synthesis is acetyl…
Q: Explain the biochemical basis of diarrhea.
A: Diarrhea is abnormally loose or watery stool, more-frequently associated with altered bowel…
Q: P P₂ 2 E*-P₁-P₂ E*-P₂ E* E E-S₁ E-S₁-S₂ Which of these 2 options represents a Sequential Ordered…
A: Enzymes are very important ad highly effective catalysts, having the ability to enhance the reaction…
Q: 1) under intracellular conditions, answer : If G3P-DH is inhibited by Iodoacetic acid, which…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: What do COX enzymes synthesise?
A: Arachidonic acid acts as the precursor of the molecules known as eicosanoids. There are two pathways…
Q: Which of the following is NOT a regulatory mechanism for digestion? Only carbohydrates are digested…
A: Introduction: The process by which our body breaks down food into small nutrient molecules is known…
Q: 53. A 16-year-old high school student comes to the office because she thinks she is pregnant. A…
A: The complete span of pregnancy is divided into terms. The pregnancy hormone is referred to as…
Q: Km V. (V) 15) + V = [S] max a' = 2 a' = 1.5 (7) -15⁰° max a Vmax 1 [S] MM a'=1 [1]
A: Most of the enzymes have certain kinetic properties. whenever a substrate is added to them, the…
Q: Briefly explain why allosteric inhibition is an example of negative heterotropic cooperativity and…
A: Heterotropic interactions observed in which the substrate binds to the enzyme at only one site and a…
Q: II. ATP ACCOUNTING Provide what is being asked for. Show all relevant calculations and summarize…
A: Lactose gets broken down to equivalent moles of Galactose and Glucose by the enzyme lactase present…
Q: What is the role of tyrosine in prostaglandin synthesis? Tyrosine provides the proton to the double…
A: Prostaglandins are mostly produced from Arachidonic acids( a C20 poly-unsaturated fatty acids) in…
Q: Which are the FIVE main series of apoproteins that have been identified? "apoA, apoB, apoC,…
A: Introduction: Apolipoproteins are the protein components of lipoproteins, the lipid-protein…
Q: * Glycerol is used for cosmetic preparations and synthesis of suppositories True False
A: Glycerol - Polyol compound and is colorless, odorless; a viscous liquid
Q: An increase in blood levels of which of the following increase the risk for atherosclerosis?…
A: Every cell in the body needs cholesterol to form cell membrane layers. These layers protect the…
Q: Consider a yeast cell undergoing fermentation but with defective alcohol dehydrogenase (hint: In…
A: The oxidation-reduction reaction is also called the Redox reaction. This reaction involves the…
Q: Among other effects, insulin is a positive modulator of the enzyme glucokinase in liver cells. If…
A: Insulin is a polypeptide hormone, which is produced by the β cells of the islets of Langerhans in…
Q: What metabolic strategies are employed to oxidize a saturated carbon? Dehydrogenation/elimination…
A: Saturated Carbon :- As carbon have 4 electron to share in its outermost shell so carbon form bonds…
Q: What is the common precursor of all phospholipids and TAG? Phosphatidic acid…
A: Phospholipids are a group of hydrophilic phosphate heads and hydrophobic tails. phospholipids are…
Q: why is energy released when IMFs form in between molecules as they approach eachther
A: In molecular terms, intermolecular forces are the forces of attraction and repulsion between…
Q: Which abbreviation is this following peptide? GKH QGR HK GHK GHL
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Consider a brain cell with non-functional Complex II of the electron transport chain (Assume that…
A: Lactose is composed of glucose and galactose units. Glucose can directly enter the glycolysis while…
Q: Using good details, compare and contrast the pairs of different biochemical reactions. Create your…
A: Introduction: The term metabolism describes the interconversion of chemical compounds in the body…
Q: A patient of 28 years old complains of pains in the spine, persistent arterial hypertension. On…
A: Hi! Since you have posted a multiple subparts questions and haven't mentioned which subparts to be…
Q: Which of the following is NOT a regulatory mechanism for catabolism and anabolism? Phosphorylation…
A: Metabolism is a series of interconnected chemical reactions occurring within a cell. Metabolic…
Q: Which of the following describe active transport or is an example of transport of a substance across…
A: The basic constituent of the cell membrane is that it is a phospholipid bilayer. The different kinds…
Q: Suppose there is a ligand binding pocket in this alpha-helix that contains residues of Leu (2), Phe…
A: Globular protein contains van der waals interactions , disulphide bridges , diploar interactions(…
Q: The free energy difference going from the unfolded state to the folded state in most proteins is…
A: The three dimensional structure of proteins ca b e destroyed by denaturating the protein. This…
Q: Consider a 24:1 △cis-9 fatty acid in the mitochondrion. For each fatty acid given, determine the…
A: Fatty acid oxidation is the process in which long-chain fatty acids are converted into acetyl-CoA.…
Q: 10 n 0 progress of reaction A graph of the free energy changes that take place during a reaction is…
A: Chemical reactions are classified into two types. Exergonic reactions that take place with the…
Q: What are ROS and examples of ROS? How do they affect the cells resulting in aging?
A: Reactive oxygen species (ROS) are oxygen-containing radicals with one or more unpaired electrons…
Q: The protein's secondary structure provide the overall arrangement of atoms. True or false
A: The secondary structure - Formed due to hydrogen bonds formed b/w the atoms of the polypeptide…
Q: What do think would happen to an individual if he/she only eats steamed "sweet potato" or "kamote"…
A: A healthy diet is very important in maintaining a healthy and disease-free lifestyle for…
Q: ALL biosynthetic reactions require which of the following metabolites(s)? NADPH Glucose 6-P High…
A: Biosynthetic reactions are the reactions that are catalysed by Enzymes to synthesise more complex…
Q: Name the monomers for all the macromolecules in Test Tubes 1-5 in Jenny's experiment. Benedict's…
A: Living organisms are constituted of four types of biological macromolecules nucleic acids, proteins,…
Q: A DNA molecule rich in C-G base pairs will have less hydrogen bonds between its two strands compared…
A: DNA, as well as RNA, belongs to the class of macromolecules. They are known to store genetic…
Step by step
Solved in 2 steps with 1 images
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNARefer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U G G G C U U U... beginning with the start codon, which amino acids, in order, are coded for by this section of mRNA? A) Thr-Met- Gly B) Met-Gly-Phe C) Ser-Asp-Gly-Leu .
- DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in RNA!) Amino acid Use the mRNA with the Genetic Code. Use the mRNA with the Genetic Code. Answer the questions below. Questions How many nucleotides would be needed to code for a protein that has 100 amino acids? Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine Lysine Serine (Look carefully. There are six possibilities) Glycine Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…What is the sequence in the DNA that specifies the codon GCU? Answer with 5’ and 3’ ends labeled.Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU ala-met-stop ala-met-stop ala-met-phe phe-ala-met
- What is the sequence in the template DNA strand during RNA production that encodes the codon GCU? Answer with 5’ and 3’ ends labeled.Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO-What amino acid does the codon AGC code for? Use the chart below. Thr (threonine) Arg (arginine) Ser (serine)
- Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart.Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids