What does A280 indicate, in assessing extracted DNA quality?
Q: Why are the correct primer sequences essential for successful amplification?
A: Polymerase chain reaction (PCR) is a widely used method in molecular biology that is used to make…
Q: what are advantages and disadvantages of using STRmix software in degraded DNA and DNA mixtures?
A:
Q: What is a poor transformation efficiency?
A: Transformation is a natural phenomenon mostly observe in many bacteria. It is dependent on the…
Q: What is the point of hydrolyzing RNA before doing biochemical tests?
A: Asked: The reason of hydrolyzing the RNA before doing biochemical tests.
Q: In gel electrophoresis, are the DNA fragments attracted to, or repelled from the negative pole of…
A: Electrophoresis is a process where charged particles move under the influence of the electric field.…
Q: What is the role of Mg2+ in genomic DNA extraction?
A: DNA extraction refers to the method of isolating and purifying DNA from a cell. It involves…
Q: In assessing extracted DNA quality, what does A280 indicate? aromatic amino acids nitrogenous bases…
A: DNA is extracted from specific cells to study the extracted DNA. The purity of extracted DNA is…
Q: What is the mom method of pacaking DNA?
A: Answer: DNA : Deoxyribonuleic Acid acts as the genetic material which transfers the genetic…
Q: In DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?
A: DNA is extracted from different sources to analyze and study the DNA sequence and diseases caused…
Q: Which Strict Operating Requirements DNA Polymerase Has?
A: DNA polymerase is an enzyme involved in the synthesis of nucleotides. These are important for the…
Q: What is the difference between positive and negative supercoiling?
A: The DNA (Deoxyribonucleic acid) is the genetic material that is inherited by offspring over…
Q: What is the criterion for DNA fragments movement on agarose gel during gel electrophoresis?
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: In making recombinant DNA, what is the benefit of using a restriction enzyme that cuts DNA in a…
A: Introduction Enzymes play a key role in biotechnological tools which helps in various invitro…
Q: What is the role of alcohol in extracting DNA? DNA is a polar molecule with an overall negative…
A: DNA stands for deoxyribonucleic acid, that is a molecule that contains the directions an organism…
Q: What is transformation efficiency and how is it calculated?
A: Transformants are the cells that are able to incorporate any modified foreign or artificial DNA.…
Q: What are the key differences between DNA microarrays and protein microarrays, and how they are used…
A: Introduction: A laboratory method used to recognize the expression of thousands of genes…
Q: Is the DNA extracted from banana pure? Explain
A: DNA (deoxyribonucleic acid) is the genetic material in all living organisms. DNA exists as a double…
Q: How did Kornberg assess the fidelity of DNA polymerase I in copying a DNA template?
A: Deoxyribonucleic acid (DNA) is a particle made out of two polynucleotide chains that loop around one…
Q: Describe the role of dideoxyribonucleotides ingenerating DNA fragments for analysis
A: Sanger developed a method to determine the sequence of deoxyribonucleic acid (DNA) called the Sanger…
Q: Explain the rationale behind a DNase I footprinting experiment.
A: Genetic Footprint or DNA profile is the basis of Human Identification Genetics. This verifies the…
Q: Why is QTL mapping in human genetic diseases important?
A: Human genetic disease or hereditary disorders is an illness brought about by changes in an…
Q: What is the formula for transformation efficiency?
A: Transformation: Transformation is a process of delivering a genetic element inside a bacterial cell.…
Q: What is meant by “error-prone” DNA repair?
A: DNA replication is a process in which two DNA molecules are synthesized from a single DNA molecule.…
Q: What different between the generated amplification product and the primer sequences in the CDS…
A: An increase in the number of copies of a gene in a genome is referred to as gene amplification. In…
Q: Who developed the sequencing-bysynthesis (SBS) approach? & When it was firstly used ?
A: Sequencing by synthesis (SBS), an Illumina sequencing method, is a commonly used next-generation…
Q: What are at least three molecules involved in DNA transcript proofreading that we reviewed? What are…
A: In humans the DNA is highly coiled to form chromosome. The DNA has many genes which can encodes a…
Q: What increases transformation efficiency?
A: Transformation efficiency refers to the efficiency by which a cell can easily take up a…
Q: Why is it necessary to use only the Klenow fragment, rather than intact E. coli Pol I, in DNA…
A: A protein fragment that is obtained when the DNA polymerase I of E.coli is enzymatically cleaved…
Q: What does A230 indicate, in assessing extracted DNA quality?
A: Option C Extraction contaminants
Q: Is DNA strand breakage necessary for catenane separation?
A: DNA is the genetic element in all cell types of prokaryotic and eukaryotic. DNA is double stranded…
Q: Why doesn't RNA interfere with DNA quantification using Dische diphenylamine?
A: Nucleic acids are the polymers of nucleotides. Nucleotides are made up of nitrogenous bases, pentose…
Q: What is a good transformation efficiency?
A: Transformation is a common phenomenon in microbes like bacteria and results in genetic alteration of…
Q: When isolating DNA, why is it helpful to control environmental conditions?
A: The ability to extract DNA is of primary importance to study the genetic causes of disease and for…
Q: What is the purpose of hydrolyzing the RNA before conducting biochemical tests?
A: Introduction: RNA is a type of nucleic acids that is a genetic material in some viruses.
Q: How did Taq DNA polymerase acquire its name?
A: Taq DNA polymerase is widely used in molecular biology studies and experiments. It is a DNA…
Q: How else can it be proven that transformants have the topA-cysB fragment apart from size analysis…
A: A transformant cell is a cell that has received additional genetic material, either experimentally…
Q: What factors could explain a transformation efficiency?
A: Transformation efficiency is the efficiency with which a bacterial cell can take up the…
Q: Describe how to select recombinant clones if a foreign DNA is inserted into the polylinker site of…
A: Introuction- pUC18 is a 2686 bps long plasmid vector which contains pMB1 as origin of replication…
Q: According to the double-strand break model, does gene conversionnecessarily involve DNA mismatch…
A: Gene Conversion means a modification or conversion of one or two alleles of a gene by the other,…
Q: What volume of 4X loading buffer must be added to 21 micro L of DNA in a technique for DNA sample…
A: Electrophoresis is the technique of seperation of RNA DNA and protein molecules on the basis of…
Q: What causes the separation of DNA fragments during agarose gel electrophoresis?
A: The technique of Gel electrophoresis is used or the separation of DNA fragments or macromolecules…
Q: What information do learn from the results of the DNA extraction?
A: Hi! Since you posted more than one question, we will be answering one for you. If you want the other…
Q: How does proofreading differ from later DNA repair mechanisms in terms of timing and the proteins…
A: Proofreading done by DNA polymerase.DNA polymerase detect error at the time of replication and also…
Q: Describe at least three proof-reading mechanisms to achieve High Fidelity of DNA replication.
A: DNA proof-reading is a process of error correction in DNA. It is also called as the DNA repair…
Q: What are the requirements for in vitro synthesis of DNA under thedirection of DNA polymerase I?
A: The formation of deoxyribonucleic acid molecules, either naturally or artificially, is known as DNA…
Step by step
Solved in 2 steps
- Q.No.4. A) Design a oligonucleotide probe for provided gene sequence using all the guidelines for efficient probe designing. ACAACCCCAAGCCTTCAACCACCCCCTTCCCCCAAATTAGAGATCGATCTCAAGAAGAAGAATGGGTTCCGTCTCTCGCTCTTCTTTGGATCAGAAGCTGGCCATGGCAAAGCGCTGCTCCCACGAGGGAGTTGTCGCGGGAGCAAAGGCGGCCGTGGTTGCAACTGTTGCCTCGGCCATTCCTACTTTGGCTAGCGTTAGGATGATCCCATGGGCGAGGTCCTTCCTTAATCCCGCAGCTCAGGCCCTCATCGTTTCATCAGCGGCGGGGGCGGCGTACTTCATAGTTGCGGACAAGACB) Specify the method for Purification of DNA fragment after digestion.(Genetic engineering).What should be the first step in the protocol for the purification of DNA from any source (including human cells)? a. Phenol extraction b. SDS precipitation c. Ethanol precipitation d. Digestion of protein with Proteinase K e. RNase digestionDescribe how TaqMan probes can specifically measure human DNA concentration, but SYBR Green I cannot-explain.
- which dos determine target of double standard RNA during RNAi? fragmentation size molecular weight none of anoveSome recombinant DNA techniques depend on the specific hybridization (or annealing) between two complementary DNA fragments. DiscussIn ion torrent DNA sequencing, covalent bond formation is detected by an ion sensor sensitive to protons. What is the source of the protons?
- Which of the following technique is used for the amplification of DNA fragments?a) AFLPb) RFLPc) RAPDd) SSLPDefine and compare the following types of nucleotide substitutions. Which is likely to cause the most dramatic mutant effect? a. missense mutation b. nonsense mutation c. sense mutationBriefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company supplying reagents and kits (eg. ThermoFisher, Qiagen, Invitrogen or similar), noting the refinements compared to the protocol used in the online practical. Include the weblink you used.
- In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2Describe the function of the following reagents used in the DNA extraction procedure?a) Proteinase K b) 5M Nacl c) Isopropanol d) 1X TE BufferWhat is the role of GelRed® in Agarose gel electrophoresis of DNA fragments? GelRed® moves down the agarose gel in response to the electric current and enables visualisation of the position of the nucleic acids within in the agarose gel. GelRed® intercalates with the Nucleic acid and, under UV light, fluoresces to enable visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the Nucleic acid and enables visualisation of the position of the nucleic acids in the agarose gel. GelRed® intercalates with the amino acids in the agarose gel and enables visualisation of the position of their in the agarose gel.
