Q: a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by…
A: Hi there! Since you have posted multiple questions, we are answering only first three sub-parts:…
Q: Why might some cells in the body, such as those in bonemarrow, be more susceptible to ribosomal…
A: Mutation It is the sudden heritable changes happening in the genotype of the organism which is…
Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…
A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…
Q: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…
A: Would a deletion of two base pairs have a greater consequence if it occurred in an intron rather…
Q: If a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA…
A: During RNA splicing Introns are removed and Exons ligated together to give rise to a functional RNA…
Q: Can methylation of nucleotides play a role in DNA replication? If so, what sort of role?
A: Deoxyribonucleic acid (DNA) involves the addition of methyl group to the DNA molecule and it can…
Q: Occurrence of each codon on human transcriptome?
A: Replication, transcription , and translation are the three main processes that cells use to preserve…
Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…
A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…
Q: How might a single base pair difference about 100 bases before the start codon of a gene cause a…
A: The first codon of the mRNA (messenger ribonucleic acid) translated by the ribosome is called the…
Q: What would happen if any of the stages involved in the translation of DNA to protein were…
A: Translation is a process in which ribosomes synthesizes the proteins in Cytoplasm after the…
Q: . Why is DNA synthesis continuous on one strand and discontinuous on the opposite strand?
A: DNA replication is the biological process by which DNA synthesis two identical replicas of itself…
Q: If the DNA template had the base sequence AGCT, whatwould be the mRNA base sequence, and what…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Some bacteria possess antibiotic resistance, as well as the ability to survive through adverse…
A: Bacteria They are small prokaryotic organisms with cell wall except some. Bacteria are both useful…
Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?
A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…
Q: What is the relationship of the new DNA chain of a daughter DNA double helix and the old DNA chain…
A: The mode of replication of DNA in living organisms occurs in a semi conservative manner. Each of the…
Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…
A:
Q: Is it biologically advantageous that DNA is stable?
A: DNA (deoxyribonucleic acid) is a double helical twisted ladder-like structure that stores and…
Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?
A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…
Q: Does the design of the Hershey–Chase experiment distinguish between DNA and RNA as the molecule…
A: Introduction: Hershey and Chase performed an experiment on the bacteriophage having DNA and protein.…
Q: How do dideoxynucleotides allow us to sequence DNA?
A: Dideoxynucleotides are chain elongating inhibitors of DNA polymerase which are used in sanger method…
Q: Why does DNA twist into the B form in living cells?
A: DNA stands for deoxyribonucleic acid which is composed of two poly nucleotide chains coil around…
Q: Does a single base-pair substitution in a strand of DNA always result in a new amino acid in the…
A: Transcription is processed to convert DNA into RNA. It is part of the central dogma. It is processed…
Q: What are the exceptions to the general rule that DNA is the genetic material in all organisms? What…
A: The exception is that RNA is the genetic material in some organisms. Many viruses have been shown to…
Q: How did the genetic code originate?
A: Genetic code includes three letters of nucleotides that code for a particular amino acid.
Q: What are introns? Where are they located in the DNA?
A: Introduction :- Before an RNA molecule is translated into a protein, non-coding portions of the RNA…
Q: How important and useful to the cell is the ability of the DNA to assume various forms? Why are…
A: Deoxyribonucleic acid (DNA) stands for deoxyribonucleic acid. It includes nucleotides, which are…
Q: What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds…
A: DNA strands are essentially polymers that comprise of deoxynucleoside monophosphate that are linked…
Q: How do we know that DNA also serves as the genetic material in eukaryotes such as humans?
A: DNA is the genetic material in our cells. they contain genetic information that controls our…
Q: Why are primers required in DNA replication but not in transcription?
A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…
Q: Why did DNA, rather than RNA, evolve to be the carrier of genetic information in cells?
A: This is one of the primary dissimilarities between DNA and RNA. DNA (Deoxyribonucleic acid) is the…
Q: In the DNA of what kind of cell must a mutation occur for the genetic change to be passed down to…
A: Mutation is any kind of change in the gene sequence of the DNA which may ultimately affect the…
Q: What is the difference in the requirement for a primer in RNA transcription compared to DNA…
A: DNA replication is the biological process of producing two identical replicas of DNA from one…
Q: What is the nature of the DNA double helix?
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: What will be the results of chemically modifying one nucleotide baseof a gene? What role is played…
A: A permanent change in the DNA’s base sequence is termed as mutation. Any alteration in DNA may cause…
Q: What different types of chemical bonds are found in DNA and where are they found?
A: Atoms are organized into molecules through chemical bonds. Chemical bonds help atoms to interact…
Q: How many codons are there in the mutated DNA-(b) and DNA-(c)? What types of mutations occurred in…
A: Codon is sequences of three DNA or RNA nucleotides.
Q: If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the…
A: In order to make the complementary strand we have to look on following things:- DNA → DNA adenine →…
Q: A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously…
A: Answer of the question given below...
Q: Whta is a homolog of a DNA ?
A: Homology refers to the similarity between a pair of structures or genes in different taxa due to…
Q: What would be the effect on DNA synthesis if the telomerase enzyme were inactivated?
A: DNA replication is the process of producing two identical replicas of DNA from one original DNA…
Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: How do histones differ from the DNA-binding proteins described in the preceding section?
A: The genome contains DNA which is packaged into chromosomes in the nucleus of the cell with the help…
Q: What is the significance of the fact that more of the DNA is in slower-moving forms?
A: DNA (deoxyribonucleic acid) is known as molecule that include the genetic code of organisms.
Q: 1944, what did he discover that DNA is responsible for
A: In the year 1928 Griffith made a remarkable discovery while working on pneumonia bacteria. He…
Q: If the gene undergoing protein synthesis consists of 24 bases, how many codons does that result in?…
A: In genetic code a unit known as codon, which codes for amino acid. For example the sequence AUG is a…
Q: Why is it not surprising that the addition of nucleotides to a growing DNA chain takes place by…
A: DNA replication, or copying of a cell's DNA, is a complicated task. There are around 3 billion base…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAG
- 5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answerTranscribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution
- Which of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Consider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence. c) What type of mutation is present in the strand 3 '- ACGGTCAATATTGCTG - 5 d) Provide the entire mutated sequence of amino acids. e) Explain the effect that this mutation will have.