Answered: During which process is MRNA…

During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase? O transcription O translation O translocation O transportation

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 14SQ: Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of...

See similar textbooks

Related questions

Q: Contains codons: O messenger RNA O transfer RNA O DNA

A: RNA is synthesized from the template strand of DNA by the action of RNA polymerase. It takes place…

Q: If you remove the terminator from a gene, how will this disrupt the function of RNA polymerase?…

A: Transcription is the process of conversion of all the information from the DNA into mRNA in the cell…

Q: Gene expression includes which two of the following processes? O A. transcription and replication B.…

A: Gene expression:- This is a process where the gene’s genetic codes are used in managing the proteins…

Q: the information stored in gene transferred to a similar molecule called RNA in the nucleus.…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA…

A: Option D is the correct answer

Q: Contains deoxyribose instead of ribose. O messenger RNA O DNA O transfer RNA

A: Nucleic acids contain the genetic information needed for functioning of cell. These are of two types…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: Where does transcription take place? O nucleus O cytoplasm O ribosome O mitochondria

A: "Hi! As you have posted multiple subparts and have not mentioned which is to be answered, we are…

Q: Which sequence regarding protein synthesis is correct?a. translation → transcription → mRNA…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION It is the process in which the genetic information present on one…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: Energy that drives transcription is provided mainly by_____ . a. ATP c. GTP b. RNA nucleotides d.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: mRNA comes from the ______________ and goes to the __________________. a. DNA, Ribosome b. DNA, RNA…

A: Step 1 RNA or ribonucleic acid is a single-stranded mixed polymer of four types of ribonucleotides,…

Q: The molecule that carries the genetic information of DNA fromthe nucleus to the cytoplasm to be used…

A: Ribonucleic corrosive (RNA) is an extra-atomic hereditary material that lies in the cytoplasm.…

Q: How does a DNA molecule produce copies of itself? O replication O expression O translation O…

A: The production of new DNA from old DNA is known as replication process. The DNA replication occurs…

Q: RNA polymerase binds to a _________ to initiate _________. a. mRNA; translation b. promoter;…

A: RNA polymerase is the enzyme that is responsible for the synthesis of mRNA from genomic DNA.

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The process of copying information from the DNA molecules into the molecule of RNA is called…

Q: Which of the following is true about transcription? O transcription begins at a start codon and ends…

A: Transcription is the process of making RNA from the template strand of DNA. It takes place in the…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…

Q: in the process of transcription, _____. mRNA attaches to ribosomes RNA is synthesized…

A: Transcription is the cycle by which the information in a strand of DNA is duplicated into another…

Q: In transcription, the nucleotide sequence CAATGGC in DNA would code for [1] in mRNA. O GTTACCG O…

A: The genes are the segments of DNA which carries information for the synthesis of the functional…

Q: What will happen if RNA polymerase fails to attach to the promoter? O Translation Will begin early.…

A: Introduction "Transcription Is The Process Of Formation Of An RNA Molecule From DNA". One Of The…

Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…

A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…

Q: Put these events of protein synthesis in the correct order First [Choose] [Choose ] RNA nucleotides…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Which process is illustrated in the diagram below? NNNNNNNNNNI Oa replication Ob.RNA processing Oc…

A: DNA synthesis inside the cell occurs when the cell decides to divide. DNA synthesis is carried out…

Q: The MRNA copy of the gene goes from the nucleus to the cytoplasm %3D The ribosome reads the…

A: Genes are the basis of genetic inheritance and they store genetic information passed on from the…

Q: What happens during the process of translation? The cell uses information from messenger RNA to…

A: The expression of the genetic material occurs generally through the production of proteins. This…

Q: Protein Synthesis genetic code DNA MRNA protein trait DNA contains the of lifel transcription…

A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell

Q: What is DNA transcription

A: The gene expression is the process in which the genetic information present in the DNA (gene) is…

Q: Put the function of mRNA is blank

A: Replication is the process of formation of identical copies of DNA. Transcription is the formation…

Q: During transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides…

A: Transcription small explanation is provided in the below step.

Q: In which direction does RNA polymerase elongate a strand of RNA? O 3' to 5' 5' to 3' Both 5' to 3'…

A: During elongation , RNA polymerase elongate a strand of RNA in 5' to 3' direction. RNA polymerase…

Q: In which direction in mRNA produced? 1. C terminal to n terminal 2. N terminal to c terminal…

A: mRNA: A DNA template of nucleotide sequence is synthesized in the nucleus which owing to…

Q: Any change in the sequence of DNA is called as O 1. transcription O 2. mitosis 3. mutation 4.…

A: well, any change in the sequence of DNA is called mutation. But for a much clearer concept, i would…

Q: What is the function of DNA ligase? put DNA together are involved in transcription break down DNA O…

A: DNA ligase then enzyme which is used to catalyse and activate the formation of phosphodiester bonds…

Q: Whcih mRNA molecule will produce more protein in translation>

A: Ans- d) mRNA with a better fit to ribosomal RNA of small subunit The translation process only…

Q: Transfer RNA molecules are involved in transcription translation O replication reverse transcription

A: t-RNA or transfer RNA molecules have a specific clover leaf-like structure. Generally, RNA molecules…

Q: What protein is responsible for reading the mrna strand and creates protein(polypeptide)

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Which form of RNA acts as a blueprint for protein synthesis in the ribosome? a. tRNA O b. rRNA O c.…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: The process of translation produces protein RNA sugar DNA none of these

A: Cells have many molecules present in the cytoplasm and organelles.

Q: Examine the diagram below. At which times is transcription and not translation occurring? Production…

A: The phenotypic characteristics of an organism are controlled and regulated by its proteome, and each…

Q: What must be translated using the Genetic Code Table to decode a specific type of amino acid that…

Q: What is the name of the building of an RNA molecule based on a DNA molecule? Transcription…

A: DNA, also known by the name of Deoxyribonucleic acid is a molecule composed of two chains that coil…

Q: What would happen if a chemical interfered with the ability of RNA polymerase to bind to the DNA…

A: Deoxyribonucleic acid (DNA) is the genetic material of living organisms. DNA provides the…

Q: The code on a DNA strand reads G C G T A A T G A. The mRNA strand would read:

A: Given: The code on a DNA strand reads GCGTAATGA.

Question

100%

What's my answer?

24
25
26
28
30
During which process is MRNA synthesized from a DNA template with the aid of RNA polymerase?
O transcription
O translation
O translocation
O transportation
MP3
C
火
2$
&
*
3
6
7
9.
e
23

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Formation of the 70S ribosomal initiation complex for prokaryotic translation requires: a.tRNAfMet b.tRNAMet c.GTP d.EF-Tu e.IF-2 f.Mn2+
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAifMet
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
Formation of the 70S ribosomal initiation complex for prokaryotic translation requires A. Mn2+ B. EF-Tu C. tRNAMet D. tRNAfMet D. IF-2 E. GTP
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
160. Which enzyme elongates/synthesizes mRNA from 5' - 3' direction? A.RNA Topoisomerase B.RNA Ligase C.RNA Polymerase D.RNA Primase
Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis: 70S initiation complex 30S initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu fMet-tRNAi fMet
Please draw the pre-mRNA that would be produced from this gene.Gray nucleotides indicate noncoding sequences. Label template strand: 5’-ACTGTGACCTTGACTGTCGATACGATG-3’ 3’-TGACACTGGAACTGACACGTATGCTAC-5’
A section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGAC
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate
List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G A A C T A C G G T A C C A T A Cb. G C A C T A A A G A T C