When Griffith incubated heat-killed virulent S strain bacteria with live avirulent R strains, he found that R cells were transformed into lethal, disease-causing bacteria. What is the molecule responsible for the transformation of R cells into the S type? Why did the transformation occur? A. Proteins in the heat-killed S cell extract; they were able to synthesize the capsular polysaccharide in the R cells and make them virulent. B. The capsular polysaccharide in the heat-killed S cell extract; the polysaccharide was able to attach to R cells, thus making them virulent. C. DNA in the heat-killed S cell extract; the DNA altered the genetic makeup of R cells, allowing them to synthesize the polysaccharide capsule, thus making them virulent. D. Specialized lipids in the cell membrane of the S cells were able to integrate with the R cells, conferring the ability to evade host immunity.

When Griffith incubated heat-killed virulent S strain bacteria with live avirulent R strains, he found that R cells were transformed into lethal, disease-causing bacteria. What is the molecule responsible for the transformation of R cells into the S type? Why did the transformation occur? A. Proteins in the heat-killed S cell extract; they were able to synthesize the capsular polysaccharide in the R cells and make them virulent. B. The capsular polysaccharide in the heat-killed S cell extract; the polysaccharide was able to attach to R cells, thus making them virulent. C. DNA in the heat-killed S cell extract; the DNA altered the genetic makeup of R cells, allowing them to synthesize the polysaccharide capsule, thus making them virulent. D. Specialized lipids in the cell membrane of the S cells were able to integrate with the R cells, conferring the ability to evade host immunity.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

When Avery and his colleagues had obtained what was concluded to be the transforming factor from the IIIS virulent cells, they treated the fraction with proteases, RNase, and DNase, followed in each case by the assay for retention or loss of transforming ability. What were the purpose and results of these experiments? What conclusions were drawn?
In the procedure shown, why was it necessary to link thecoding sequence for the A or B chains to the sequence forβ-galactosidase? How were the A or B chains separated fromβ-galactosidase after the fusion protein was synthesized in E. coli?
(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BLAST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical.a. Explain this observation.b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?
Given the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)
What is single-cell protein? Explain the reasons for the removal or reduction of nucleic acid in Single Cell Protein.
Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
For each of the following ( A & B ) provide the method of transfer and a brief explanation as to why the method would not take place under the conditions described . 1. Which method of DNA transfer between bacteria would not take place if the donor and recipient were separated by a filter with a pore size of 0.45 um or another physical barrier 2. Which method of transfer would be blocked by the presence of high concentrations of DNAase ( enzymes capable of degrading DNA ) ?
In a-c below, will the residue on the right-hand side increase or decrease the pKa of the residue on the left-hand side? Explain.
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′