In the: Exposure to a substance that mutates the Shine-Dalgarno sequence. Explain: (a) What is the process affected? (b) What is the Effect on the process? (c) Does it affect prokaryotes, eukaryotes or both?
Q: List the two components of the active Telomerase holoenzyme.
A: The ribonucleoprotein that is responsible for the synthesis of telomeric repeat sequence is called…
Q: Is the statement "Nucleic acids are found in the nucleoid region of prokaryotes" incorrect or…
A: Unlike prokaryotes do not have seperate compartment like nucleus where nucleic acids are found.
Q: Considering prokaryotes, what is the enzyme that links the tRNA molecules to its correct or cognate…
A: Ans- tRNA molecules serves as the link between the amino acid form of proteins and the genetic code…
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: The difference between prokaryotic and eukaryotic protein initiation is that eukaryotes' initiator…
A: Translation is the process of Synthesis of proteins from amino acids by peptide bond formation. It…
Q: All are factors or subunits contained within the E. coli RNA polymerase holoenzyme in prokaryotic…
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Why is it important to put regulatory mechanisms in place at specific portions of the pathway from…
A: The flow of the information takes place from DNA to the proteins. Proteins act as structural…
Q: Considering prokaryotes, what is the enzyme that removes the RNA primer and replaces it with newly…
A: RNA primer is used in initial priming to then later on DNA ligase can not seal the nick between the…
Q: Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify…
A: Proteins are made up of a string of amino acids the sequence of which is encoded by DNA. Each amino…
Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both
A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…
Q: List some common causes of spontaneous and inducedmutations.
A: Spontaneous mutation is defines as the error or changes occur in natural biological process of any…
Q: How does a disorder in mitochondria lead to diabetes? What kind of diabetes is it?And Which two…
A: Mitochondrial disorders:These disorders harm the proper functioning of mitochondria (powerhouse of…
Q: Considering that genes can code only for RNA orproteins, how can the synthesis of nonprotein…
A: A gene is the basic physical and functional unit of heredity. They are made up of DNA.
Q: The terminal inverted repeats of a DNA transposon or a retrotransposon bind an enzyme of what…
A: Transposons are mobile elements present in the genome of an organism. There are responsible for the…
Q: Using sickle-cell anemia as a basis, describe what is meant by a genetic or inherited molecular…
A: A disease is an abnormal condition of the body or body that does not work properly and causes a…
Q: _____ Mutants Are Useful in ______ the Order in Which Proteins Function.
A: Saccharomyces cerevisiaes, or baker’s yeasts, unicellular fungi are useful in understanding genetics…
Q: In the: Inhibition of splicing by ribozymes Explain: (a) What is the process affected? (b) What is…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: For you, what is the contribution around 18-1900 of golden era in biochemistry? Explain
A: Introduction: The term biochemistry refers to the study of the chemistry of living things including…
Q: In studies of frameshift mutations, Crick, Barnett, Brenner, andWatts–Tobin found that either three…
A: A frameshift mutation is a genetic mutation caused by insertions or deletions of a number of…
Q: In biochemistry mechanisms, what group is often attacked by a nucleopile?
A: A nucleophile is a chemical species that donates an electron pair to form a chemical bond in…
Q: Explain why RNase A cannot catalyze the hydrolysis of DNA.
A: RNase A is a pancreatic ribonuclease enzyme that cleaves single-stranded RNA. It belongs to a large…
Q: You are studying a bacterial metabolic pathway that results in the synthesis of a product, vitalin,…
A: Given information: Bacteria has metabolic pathways that helps in synthesizing the product vitalin,…
Q: The xenobiotic molecule ethyl chloride (CH3CH2Cl) is mutagenic. To what class of mutagenic…
A: The term xenobiotic is composed of two words, “Xenos” meaning “foreign” and “biotic” meaning…
Q: Which of the following statements regarding Anfinsen's denaturing experiments with ribonuclease A…
A: Anfinsen worked with Ribonuclease A and showed how can the protein be denatured or it can regain its…
Q: Which of the following is defined as transformation?
A: Which of the following is defined as transformation? Answer. Option (C) . Free-floating DNA is…
Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?
A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…
Q: The following enzyme has an exact integer number of turns. What is the length and amount of amino…
A: Enzyme are usually composed of proteins while some enzymes are ribozymes (RNA enzymes). Proteins are…
Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…
A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…
Q: You are studying a bacterial metabolic pathway that results in the synthesis of a product, vitalin,…
A: Mutants means tbe strain of the bacteria lacking the gene expressing for that particular enzyme.…
Q: N-formylmethionine is the amino acid specified by a tRNA molecule carrying the anticodon sequence…
A: N-formylmethionine It is use as starting amino acids during the synthesis of proteins in…
Q: According to molecular sequence data, to which prokaryotic group are eukaryotes more closely…
A: Molecular sequence data plays a crucial role in the determination of closely related species.…
Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…
A: BASIC INFORMATION GENETIC CODE The genetic code term was coined by George Gamow. There are total…
Q: Where does the energy of such reaction catalyzed by an RNA polymerase come from?
A: RNA polymerase catalyze the DNA dependent RNA synthesis. It catalyzes the process of transcription.
Q: A researcher creates random copolymers of three nucleotides each by mixing polynucleotide…
A: Genetic code is the the sequence of nucleotide in deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: Which of the following enzymes has 5' to 3' exonuclease activity?
A: 5’ to 3 ‘ exonuclease activity is the ability to remove nucleotides by enzymes. The nucleotides are…
Q: What feature of eukaryotic translation is especially responsible for its efficiency?
A: Genetics is the investigation of heredity. Heredity is a natural interaction whereby a parent passes…
Q: You are a physician who has diagnosed a patient with a genetic condition that results in telomerase…
A: Telomere is the sequence of repetitive nucleotides present at the ends of the chromosomes. Telomeres…
Q: Explain the nucleoside diphosphates (NDPs) ? How it is formed ?
A: Nucleotides are the genetic material in living organisms. They are packed in the nucleus in…
Q: The structure of adenylate cyclase is similar to the structures of some types of DNA polymerases,…
A: adenylate cyclase DNA polymerases Convert ATP to cAMP Adds dNTP to DNA Plays role in signal…
Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…
A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…
Q: Human ribonucleotide reductase has two allosteric sites, the S site and the A site. What is the…
A: Human ribonucleotide reductase in a mammalian enzyme that is responsible for the conversion of RNA…
Q: If the experiment containing galactose were allowed to continue unchanged for 24 hours, what do you…
A: Galactose is a type of carbohydrate. It is a monosaccharide that has the same molecular formula as…
Q: Please describe the enzyme - mediated reactions required for a histidine, freely floating in the…
A: Histidine is a amino acid which is used in protein biosynthesis. The biosynthesis of histidine…
Q: Prokaryotes and Eukaryotes InitiateTranslation Differently or same?
A: Prokaryotes are the organisms that lack the cell nucleus and membrane-bound organelles. They have…
Q: What feature of RNA would allow it to function as a ribozyme? Why are there no naturally occurring…
A: An RNA that has enzymatic activity called ribozyme.
Q: What is the difference between eukaryotes and prokaryotes in terms of initiator tRNA?
A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…
Step by step
Solved in 2 steps
- The structure of adenylate cyclase is similar to the structures of some types of DNA polymerases, suggesting that these enzymes derived from a common ancestor. Compare the reactions catalyzed by these two enzymes. In what ways are they similar?If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?Is the statement "Nucleic acids are found in the nucleoid region of prokaryotes" incorrect or correct?
- As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion How do we know, based on studies of Neurospora nutritionalmutations, that one gene specifies one enzyme?In biochemistry mechanisms, what group is often attacked by a nucleopile?In the procedure shown, why was it necessary to link thecoding sequence for the A or B chains to the sequence forβ-galactosidase? How were the A or B chains separated fromβ-galactosidase after the fusion protein was synthesized in E. coli?
- using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?You are a physician who has diagnosed a patient with a genetic condition that results in telomerase with lower than normal enzymatic activity. How might you have diagnosed this disease? What symptoms should be a clue? Explain.Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Considering that genes can code only for RNA orproteins, how can the synthesis of nonprotein substancessuch as carbohydrates or steroids be under geneticcontrol?Crick's Central Dogma states that there is a unidirectional flow of genetic information DNA ---> RNA -----> Protein Explain why this may not always be the case. (Describe a scenario in which movement may occur in the opposite direction).
