Which answer correctly summarizes the plcture below:A.8989回B.(A) is showing a DNA strand and (B) shows that DNA strand wrapped aroundproteins. (O is showing further folding of DNA untilit gets to (D) aheavilycondensed chromosome,CWisshowing a condensed chromosome and (B) shows the chromosomewrapped around proteins. (C) hows the furtherflding.of the chromosome toform the end result of DNAshown as (D).Mhowing a hlycondensolchromosome that goes through funher foldingshown in (B) (Oshowing a DNAmeecutrwith (D) showinghow DNAwrapsaround proteinsJALNONAan(8rshows.ho atbNA omake.proteinsC,shaws

A) At the simplest level, chromatin is a double stranded helical structure of DNA. B) DNA is…

Which answer correctly summarizes the picture below: A. B. D. (A) is showing a DNA strand and (B) shows that DNA strand wrapped around. proteins. (C) is showing further folding of DNA until it gets to (D), a heavily condensed chromosome. A) is showing a condensed chromosome and (8) shows the chromosome wrapped around proteins. (C) shows the further folding of the chromosome to form the end result of DNA shown as (D). Wis showinra highly condensod chromosone thal oes through turther folding shown in (B). (O is showing a DNAmalecule with (D) showinghow DNA wraps around proteins. AS DNA and (Bishowshiow that DNARed.to mske preleins. (O shows thow the proteinefoldin stopto form the chromosomes shomintD),

Which answer correctly summarizes the picture below: A. B. D. (A) is showing a DNA strand and (B) shows that DNA strand wrapped around. proteins. (C) is showing further folding of DNA until it gets to (D), a heavily condensed chromosome. A) is showing a condensed chromosome and (8) shows the chromosome wrapped around proteins. (C) shows the further folding of the chromosome to form the end result of DNA shown as (D). Wis showinra highly condensod chromosone thal oes through turther folding shown in (B). (O is showing a DNAmalecule with (D) showinghow DNA wraps around proteins. AS DNA and (Bishowshiow that DNARed.to mske preleins. (O shows thow the proteinefoldin stopto form the chromosomes shomintD),

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 1ACQ: Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired...

See similar textbooks

Similar questions

The average human chromosome contains about 1 x 108 bp of DNA.(a) If each base pair has a mass of about 660 daltons and there are about 2 g of protein (histones plus nonhistones) per gram of DNA, how much doessuch a chromosome weigh (in grams)?(b) If the DNA were extended, how long would it be?(c) An actual chromosome is about 5 mm long. What is the approximatecompaction ratio?(d) You have about 4 x 1012 cells in your body. If you have 46 chromosomes in each cell, what is the approximate extended length of all of your DNA? For comparison, the distance from the earth to the sun isabout 1.5 x 108 km.
Give only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'
The average human chromosome contains about 1 x 108 bp of DNA. (a) If each base pair has a mass of about 660 daltons and there are about 2 g of protein (histones plus nonhistones) per gram of DNA, how much does such a chromosome weigh (in grams)? (b) If the DNA were extended, how long would it be? (c) An actual chromosome is about 5 mm long. What is the approximate compaction ratio? (d) You have about 4x 1012 cells in your body. If you have 46 chromosomes in each cell, what is the approximate extended length of all of your DNA? For comparison, the distance from the earth to the sun is about 1.5x108 km.
When chromatin is treated with non-specific nucleases, what is the length of the resulting pieces of DNA
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Figure 9.10 You isolate a cell strain in which the joining together of Okazaki fragments is impaired and suspect that a mutation has occurred in an enzyme found at the replication fork. Which enzyme is most likely to be mutated?
4–44 You have been sent the first samples of a newly discovered Martian microorganism for analysis of its chromatin. The cells resemble Earthly eukaryotes and are composed of similar molecules, including DNA, which is located within a nucleus-like structure in the cell. One member of your team has identified two basic histone-like proteins associated with the DNA in roughly an equal mass ratio with the DNA. You isolate nuclei from the cells and treat them with micrococcal nuclease for various times. You then extract the DNA and run it on an agarose gel alongside DNA from rat-liver nuclei that had been briefly digested with micrococcal nuclease. As shown in Figure 4–9, the digest of rat-liver nuclei gives a standard ladder of nucleosomes, but the digest of the Martian organism gives a smear of products with a nuclease-resistant limit of about 300 nucleotides. As a control, you isolate the Martian DNA free of all protein and digest it with micrococcal nuclease: it is completely…
18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?
What is the basic difference between DNA, gene, chromosome, & chromatin? If chromosome does not condensed with histone protein, what problems may occur?
41. Define the relationship between twist, writhe and linking number. Are the twist and writhe topological properties or geometric properties? Why is this significant? What is the twist and writhe of relaxed (but not broken) circular DNA?
A part of a sequenced chromosome has the sequence (on one strand)ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG. Which part of thissequence is most likely to take up the Z conformation?
5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer. Strand 1: 5′ATTATTTTAAATTTAGCGC3′ Strand 2:5′AAAAAATTTTTTTTTCCGG3′ 5.2) A newly discovered blob protein folds very rapidly in the presence of protein disulphide isomerase and peptidyl prolyl cis-trans isomerase enzymes but aggregates and never folds correctly without protein disulphide isomerase. Explain why this might occur.