Which do you think is more effective strategy for biodiversity conservation, Maintaining a Single but Large or Small but Several habitats? Choose one

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: What could be the effect of Isthmus of Panama to marine and terrestrial organisms in North and South…

A: Introduction The Isthmus of Panama also historically known as the Isthmus of Darien, separates the…

Q: Angiotensin is a hormone that stimulates vasoconstriction and increases blood pressure. Which effect…

A: Answer :- Option (D) is correct. - decreased reabsorption of sodium in the kidneys.

Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…

A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…

Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…

A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…

Q: Ashu did a titer assay with her phage lysate. She started with 100µL of phage lysate (10) and did 7…

A:

Q: Question 4 of 25 Use the diagram to answer the question.     Some organisms use a single loop…

A: The single loop heart is found in lower organisms (fish), in which the blood pressure and oxygen…

Q: Monosaccharides enter central meta O Glyoxylate shunt O Oxidative phosphorylation O Glycolysis O…

A: Ans- the correct answer for the above question is-  D) OXIDATIVE PHOSPHORYLATION TCA CYCLE. Central…

Q: in what meitotic phase we can identify bridge abberation? anaphase I or Metapahse I?

A: During cell cycle breaks are induced after DNA synthesis . During chromatid abberation…

Q: Lungfishes Amphibians Mammals Amnion Lizards and snakes Crocodiles Ostriches Feathers Hawks and…

A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…

Q: Describe the three domains of a receptor tyrosine kinase. Explain the structure of the…

A: Receptor Tyrosine kinase are the most effective high affinity cell surface receptors that acts for a…

Q: O5-CAGCAUUA-3'

A:

Q: What are the environmental climatic and bio-physical requirements of lowland rice

A: Answer :- Rice crop needs a hot and humid climate. It is the most appropriate to districts which…

Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…

A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…

Q: What are nutritional disorders

A: Introduction :- Any nutrient-related disease or condition that causes illness in humans is referred…

Q: . Why is the relationship P=p2 used for homozygous loci?

A: Introduction :- Homozygous for a given locus refers to diploid and polyploid cells that have the…

Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…

A: The process of urine formation is done in the nephrons present in the kidneys. The nephrons are…

Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…

A: The renal system's primary activities include the management of ECF volume and blood pressure, the…

Q: Leo, 37-years old was absolutely shocked when he found out that he has a hypertension. He was once…

A: Kidney are the chief organ of Urinary system in which formation of urine takes place via nephrons as…

Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.

A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: 22. It is a microbial infection of the bladder. 23. It is the infection of the renal pelvis. 24. It…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: 1. Use the below pedigree chart to answer the following questions about dimples. The Dimple gene…

A: The genotype of a cell or organism is the genetic code of that cell or organism. The sum of all…

Q: 2 5

A: The digestive tract of pigs is monogastric or nonruminant. It is similar to humans as monogastric…

Q: Name and describe the main fuctional macromolecule found in red blood cells

A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…

Q: Why are there so many marsupials in Australia but not in South America?

A: Australia is the kingdom of marsupials containing marsupials such as kangaroos, koalas and wombats.…

Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…

A: This question is about gene.

Q: Do you think that Leo needs to drink more water prior to his exercise? Explain why?

A: Dialysis is a technique to eliminate byproducts and excess liquid from the blood when the kidneys…

Q: is a normal cellular gene that through a A an oncogene. OA) proto-oncogene...loss-of-function OB)…

A: An oncogene is a cancer-causing gene that has been mutated. A proto-oncogene is a type of oncogene…

Q: Please answer fast and all question other wise I will give downvote. QUESTION 1 Why is cancer a…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Equipment or materials used in immobilizing and separating cells of streak, pour and spread method.

A: Answer :- We need to understand one by one are as follow :-  * Equipment or materials used in…

Q: Macroevolution deals with the evolution of new species that takes place over long periods of time…

A: Macroevolution is a word that relates to evolution that occurs above the level of a single species.…

Q: A protein that has been reversibly denatured has Multiple Choice temporarily lost part or all of its…

A: Answer :- Option (C) is correct. - Temporarily lost part or all of its secondary and tertiary…

Q: Question 53 Protists (Kingdom Protista) can be: O none of the choices are correct O autotrophic O…

A: We will answer the first question as question number that needs to be solved is not mentioned.…

Q: Binding of epithelial growth factor (EGF) to its receptors will result in Ras A) shutting down cell…

A: .A gene that controls cell proliferation and can function as a transcription factor, growth factor,…

Q: Styles raph Lungfishes Amphibians Mammals Tetrapod limbs Lizards and snakes Amnion Crocodiles…

A: A tree like or comb like taxonomic relationship among different group of organisms is called…

Q: In the 33 hr. chick embryo stage what structure/s would serve as a guide to approximately…

A: Auditory vesicles are distinct. Three pairs of arterial arches arise from the ventral aorta. Somites…

Q: How can Ghana increase production of Papain

A: Papain is the enzyme mainly proteolytic enzyme, has great importance. Papain is extracted from the…

Q: What is human Intelligence?

A: The ability of human brain or mental quality is basically the human intelligence. It includes the…

Q: Describe all of the ways in which RNA is modified after transcription in eukaryotic cells

A: Transcription of creating RNA from a template of DNA. It can be found in the nucleus of eukaryotes.…

Q: What volume of 10X TBE buffer should you use to make 100mL of 1X TBE buffer? 10mL 1mL 0.1mL 100mL

A: TBE buffer stands for Tris-Borate-EDTA buffer. It is used for both agarose and polyacrylamide gel…

Q: RNA that, combined with protein into multiple sun bits, constructs a peptide chain must be called…

A: RNA that, combined with protein into multiple sun bits, constructs a peptide chain must be the tRNA.…

Q: Using the table below, differentiate the effect of two varying pH levels (as indicated by by the…

A: The enzyme amylase, which is present in saliva, has its maximum activity at pH 7. The activity of…

Q: After fertilization the integument(s) of gymnosperms and angiosperms becomets O nutritive tissue O…

A: The integuments are the ovule's outer layer(s), which mature into a seed coat as the ovule matures…

Q: Given the scenario, compute for the total volume of the culture media solution (milliliter or liter)…

A: We have been given the concentration of the nutrient broth and Agar and we have also been given the…

Q: You have a photoreceptor cell in a dish. You are recording its membrane potential while flashing…

A: Answer :- Option (B) is correct. - The cell depolarizes, with brighter light causing more…

Q: Which of the following is considered to be a spontaneous source of mutations that impact the genome?…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: The titer of Lauren's phage is 3.7 X 108 pfu/mL. She diluted her phage lysate 1:10 from 10° to 10-7…

A:

Q: Marie diluted her phage lysate from 10° to 109. She completed the titer assay protocol using these…

A: This question is about dilution.

Conservation Biology

The study of how to prevent the loss of biological diversity on the planet is called conservation. Biological diversity, also termed biodiversity, consists of various life forms found in a specific location or across the entire planet, including ecosystems, species, populations, and genes. Conservation thus aims to protect the diversity of life at all levels of biological organization.