What is the mRNA made using the template/non-coding strand DNA sequence5'-GTCGTAAT-3'O 5-CAGCAUUA-3'O 5'-GUCGUAAU-3'O 5'-UAAUGCUG-3'5'-AUUACGAC-3'O 5'-CUCGUAAU-3'Question 11as a/an

Answered: Image /qna-images/answer/7e7028e5-f257-4cb0-b893-94812bb1f759.jpg

Answered: O5-CAGCAUUA-3'

Science

Biology

O5-CAGCAUUA-3'

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 17RQ: An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size...

See similar textbooks

Related questions

Q: Describe the process of Translation of MRNA to DNA.

A: Translation is the second phase of protein synthesis. It follows transcription, in which the…

Q: Why do scientists isolate DNA?…

A: There are different techniques to study DNA and gene present in it.

Q: explain why biodiversity is the life insurance of itself?

A: Biodiversity- Biodiversity is the biological variety and variability of life on Earth.

Q: 40 words or fewer. Explain why we would not survive without primary producers, in particular…

A: Introduction :- Primary producers, also known as autotrophs, are organisms that get their energy and…

Q: When Charles Darwin discovered the various finch species on the Galápagos islands, he was surprised…

A: Introduction :- The presence of certain traits gives a population a competitive edge, making it more…

Q: With the aid of diagrams, and using specific examples, describe how gene expression is regulated in…

A: Transcription Is the process of formation of mRNA from DNA and this happens in the cytoplasm of the…

Q: QUESTION 15 Which of the following does not change gene frequencies in populations? selection O…

A: Introduction :- The relative frequency of an allele (gene variant) at a specific locus in a…

Q: Question 64 The vertebrates that lack jaws are called O rays. O turtles. O lampreys. O eels. MacBook…

A: Since you have asked multiple questions from different topics at a same time we will answer only 1st…

Q: Match the evidence of evolution with its description: f Comparative Anatomy a. structures that don't…

A: Comparative anatomy - comparin strucrures to show species has shared ancestry. Homologous organ -…

Q: List three characteristics that distinguish Homo sapiens from premodern Homo Homo sapiens have a…

A: Scientific data gathered on human evolution suggests that the physical as well as behavioral…

Q: 1. The physical factor influencing water entry into and exit from cell interior resulting in…

A: Introduction A pathogenic bacterium, or microbial cell, is a living entity that is too small to see…

Q: What is composite materials? Describe biomass derived composite materials by picking one biomass.

A: INTRODUCTION Biomass refers to the mass of living beings such as plants, animals, and microbes, as…

Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…

A: The construction of this question gives us an information about the nature of protein P, P when…

Q: Question 53 Protists (Kingdom Protista) can be: O none of the choices are correct O autotrophic O…

A: We will answer the first question as question number that needs to be solved is not mentioned.…

Q: 12. There are different types of symblotic relationships between different specles. Match the type…

A: Introduction Ecology is the study of the environment, and it helps us understand how species…

Q: You take a sample of cancerous tissue from Individual II-6 from the prior question. What will the…

A: X- linked inheritance X linked inheritance is a pattern of inheritance when the trait is controlled…

Q: 9. Suppose you accidentally introduce a small plant-eating beetle into your self-contained…

A: You construct a self-contained ecosystem in a jar, following some instructions. Your ecosystem…

Q: A classical experiment studying the fate determination of stem cells in the developing embryo uses…

A: Introduction Muscles are a type of soft tissue. muscles are made up of a lot of flexible fibres.

Q: Explain why STR mutations are found at a much higher frequency than single nucleotide changes?

A: STR means single tandem repeat, and the mutation in the STR segments is at a very high rate .

Q: A __________ is the form of collective behavior that hasthe most structure, lasts the longest, and…

A: Common forms of collective behavior discussed in this section include crowds mobs panics riots…

Q: Elaborate the pros and cons of using commercial or synthetic plant hormones.

A: Advantage: Synthetic hormone like auxin can do same function as the natural auxine do. In low…

Q: Benzoic acid has an absorption maximum at 230 nm. Where do you expect (give a value) to see the…

A: The neutral benzoic acid is acidic in nature and at pH lower than 7 benzoic acid obtain high…

Q: How could immunoglobulin cross-reactivity between foreign antigens and host cell antigens result in…

A: Introduction Immunoglobulins are antibodies produced naturally by the immune system of the body that…

Q: A scientist hypothesizes that dysregulated insulin signaling is responsible for the development of…

A: Metabolic syndrome A cluster of conditions that increase the risk of heart disease, stroke and…

Q: Describe the process of DNA replication of the leading strand?

A: ANSWER;-

Q: principle of a plant virus that transmits through an animal vector

A: A virus is a small microscopic infectious microbe that is non-living until and unless it finds a…

Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to

A: Sickle cell disease is a group of disorders of blood generally inherited from parents to their…

Q: Explain why this statement is true, using phylogenetic and morphological evidence. Tunicates…

A: Tunicates are transparent or brilliantly colored marine animals that are found on the dock pilings,…

Q: 5. What causes allele frequencies to differ between biological populations?

A: Allele frequency refers to the how common and Allele is present in a population It is determined by…

Q: 22. It is a microbial infection of the bladder. 23. It is the infection of the renal pelvis. 24. It…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: Case one: A 45 years old male who is a participant in a new medicine trial that blocks the renal…

A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…

Q: In the DNA of any individual human, about 300 mutations may differentiate the genome from either…

A: Introduction Gene:- A gene is the basic physical and functional unit of heredity. It is a part of…

Q: (a). What is the role of calcium ions and troponin during contraction in striated muscles of hum

A: Introduction - Myofibrils, which contain a specialised protein (myoglobin) and chemicals to deliver…

Q: Define the genetic disorder Huntington's disease and the mode of inheritance (Dominant, Recessive,…

A: Answer 1 : Huntington's diseases is the condition in which the nervous cells breaks in the brain…

Q: in what meitotic phase we can identify bridge abberation? anaphase I or Metapahse I?

A: During cell cycle breaks are induced after DNA synthesis . During chromatid abberation…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…

Q: economic and ecological significance of Barley (Hordeum)

Q: A Moving to another question will save this response. Question 9 Which of the following statements…

A: When considering workout for weight loss or muscle gain, it's a better idea to be consistent and…

Q: 5. Pernicious anemia is a disease in which the intestine is unable to absorb vitamin B12, frequently…

A: As already mentioned in the question pernicious anemia is a disease which occurs due to inability of…

Q: Describe the process of Translation of MRNA to DNA.

A: The process of the process from a DNA strand into a new RNA ( mRNA ) molecule is known as…

Q: Compare and contrast the adaptive structures of the insect ectoparasites and the endoparasites.…

A: Ectoparasites are organisms that live just on skin of humans and other animals and are classified as…

Q: Genetic problems: Use the diagram below to figure out how each monosomy or trisomy can a) Normal X…

A: 1) Trisomies and monosomies are two types of chromosomal abnormalities. Specifically, a trisomy is…

Q: This process involves plastocyanin.

Q: Describe the behavioural and physiological adaptations that enable many rodents to thrive in arid…

A: Introduction "Adaptation is a physical or behavioural trait of an organism that aids in the…

Q: Give economic and ecological significance of Wheat species (Triticum).

A: Introduction Wheat is a grass that is commonly farmed for its seed, a cereal grain that is a staple…

Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…

A: ANSWER) (a) finding the e-value of phage proteins The BLASTp helps to predict the function of phage…

Q: Which of the following is not true regarding DOGEMs sequencing? it could result in more than one…

A: Answer :- Option (A) is correct. - It could result in more than one complete phage genome sequence.

Q: What cell receptor does adrenaline reach

A: Adrenaline or epinephrine is a hormone released by the medulla of the adrenal glands. It is released…

Q: U2, the energy of this reaction is coupled to ne pumping of H+. Drug Y can pick up electrons from…

A: Electron transport chain is the last step of cellular respiration. The first being glycolysis the…

Q: You are examining a set of genes from a phage that are transcribed late in infection. You know that…

A: This question is about gene.

Question

What is the mRNA made using the template/non-coding strand DNA sequence
5'-GTCGTAAT-3'
O 5-CAGCAUUA-3'
O 5'-GUCGUAAU-3'
O 5'-UAAUGCUG-3'
5'-AUUACGAC-3'
O 5'-CUCGUAAU-3'
Question 11
as a/an

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
Energy that drives transcription is provided mainly by _______ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerase
Which DNA strand is complementary to this template strand: 5’-GACGCT-3’? A. 5’-AGCGTC-3’ 3’-AGCTAG-5’ 5’-GACGCT-3’ 3’-GATCGA-5’ 5’-UCGAUC-3’ Which mRNA strand is transcribed from the above template DNA strand (the original)? 5’-GAUCGA-3’ 3’-CUGCGA-5’ 5’-CUAGCU-3’ 3’-TCGATG-5’ 5’-AGUGUC-3’ Which tRNA anticodon is complementary to the first mRNA codon (above)? 5’-GAU-3’ 3’-UAC-5’ 5’-AGC-3’ 3’-CGU-5’ 5’-GCU-3’
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
Which mRNA strand is complementary to this template DNA strand: 5’-CTGCAT-3’? 3’-AUGCAG-5’ 5’-CAUCUG-3’ 3’-CUGCAU-5’ 5’-AUCGAC-3’ 3’-GACGUA-5’ Which tRNA strand is complementary to the first codon in the above mRNA strand? 3’-GAC-5’ 5’-AUG-3’ 3’-CAU-5’ 5’-CAU-3’ 3’-AUG-5’ Which of the following amino acids is coded for by the above tRNA molecule (in a typical eubacterial cell like E. coli)? methionine N-formylmethionine threonine phenylalanine tyrosine
5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription start site is bold. Transcribe template DNA to mRNA. Make sure you write mRNA in the 5’ to 3’ direction. This is tricky – don’t assume the polymerase knows right from left. It can only synthesize new DNA in 5’>3’ direction.
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’