Which methodologies can be used to detect the expression of a given protein? Please provide pros and cons of each mentioned approach.
Q: When cellular ATP levels decline, describe its detailed effect on nucleotide biosynthesis and what…
A: A pentose sugar, a nitrogenous base, and a phosphate molecule constitute a nucleotide. Purines and…
Q: (a) (b) (c) (d) Identify the type of enzyme immobilization technique. [Kenalpasti jenis teknik…
A: Enzyme immobilization is the process of immobilizing enzymes and thereby prevent their free…
Q: A protein has a number of aspartyl and gluatmyl residues, what would be the expected pl for this…
A: pI refers to the isoelectric point of a molecule, including proteins. It is the pH at which the…
Q: Which statements about absorption of vitamins or minerals are true? Select all that apply. U…
A: Minerals and vitamins are essential nutrients that play vital roles in maintaining overall health…
Q: By mistake, you add two primers to your DNA sequencing reaction. The primers anneal on the same…
A: The correct answer is:B. The detector will detect two nucleotides at about 75% of the positions.
Q: 19. Which of the following statements is true for the shown reactions? ů C-S-COA CH₂ I H₂C-C-0H CH₂…
A: The reaction shown in the question is a part of the ketogenesis pathway. When the body has a limited…
Q: Which of the following activate glycogen synthesis? A. Phosphorylation of glycogen synthase kinase…
A: Hepatocyte glucokinase is inhibited through a specific inhibitory protein, GRP and GRP is a nuclear…
Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…
A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…
Q: depicts the effect of an inhibitor on the initial velocity (Vo) of an enzyme at different substrate…
A: Enzyme inhibition depends on the inhibitors and their action is seen by the Lineweaver Burk plot…
Q: wouldn't ADP, a reactant of the other (phosphorylating) pathway, tend to inhibit the competing…
A: Glycolysis is a series of chemical reactions used by all aerobic organisms to release stored energy…
Q: 4. If the range for your control is 5.2-6.8 mmol/L is your control acceptable?
A: Glucose is a monosaccharide and is mainly all the complex carbohydrates that break down into glucose…
Q: 10.94 Solution X has a pH of 9.0, and solution Y has a pH of 7.0. (10.6) a. Which solution is more…
A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…
Q: 35. Which of the following is true? A. All 20 common amino acids have an amino group and a carboxyl…
A: Amino acids are biomolecules that have an amino group and a carboxyl group, a hydrogen atom and a…
Q: All nucleic acid samples regardless of conformation and type will use the same absorption constant…
A: Quantification of all nucleic acids in the sample is done to determine the concentration in the…
Q: The hydrolysis of glycogen to yield glucose is catalyzed by the enzyme phosphorylase. Caffeine,…
A: Glycogen phosphorylase is an enzyme that catalyzes the breakdown of glycogen into…
Q: 14. Which of the following statements is true for the shown reaction? ℗P-O-CH₂ BCH, OH A O MOTHE…
A: Glycolysis is the stepwise oxidation of 6-carbon glucose to two 3-carbon pyruvate by 10 enzymes…
Q: a What would be the appropriate name for an enzyme that catalyzes each of the following reactions: b…
A: The six types of enzymes are: Lyase- catalyzes the cleavage of C-C, C-O, C-N or others by…
Q: After obtaining the results from the laboratory, it is suspected that the patient might have a…
A: As described in the diagram provides, active form of Vitamin D is needed for absorption of dietary…
Q: Match the description on the left with the terms on the right. A component of cytochromes Exist in…
A: Both hemoglobin (Hb) & myoglobin (Mb) are globular proteins.Hemoglobin help to transport oxygen…
Q: glucose will be more readily phosphorylated by glucokinase than hexokinase hexokinase will…
A: The main difference between the enzymes Glucokinase and Hexokinase is their location. Hexokinase is…
Q: 11. Anomers can be interconverted ________. A. by an isotopic exchange reaction B. by rotation…
A: Anomers are a specific type of stereoisomers that differ in their configuration at the anomeric…
Q: What components make up an ADT and how is it put together? What is your reaction,
A: ADT stands for Adenosine 5'-diphosphate. It is one of the nucleotides that is essential for many…
Q: 15.76 Because peanut oil floats on the top of peanut butter, the peanut oil in many brands of peanut…
A: Triglycerides or triacylglycerides or triglycerols are fatty acid esters of glycerols. In…
Q: 9. Classify the enzyme catalyzing the following reaction A. oxidatio/reductase B. lyase C. kinase D.…
A: Protein-based biological entities known as enzymes serve as catalysts in a variety of chemical…
Q: draw a “trans” and a “cis” peptide bond of alanine and threonine with the peptide bond lying in the…
A: The angle between the two planes in a molecule is called as the torsional angle or dihedral angle.…
Q: Acetaldehyde + NADH + H+ → Ethanol + NAD+ How is the inhibition constant for this gotten? Determine…
A: The enzyme is a biomolecule that catalyzes the reaction by binding to the…
Q: (a) What is the theoretical yield of ATP/NADH using the measured change in free energy of -208…
A: Change in free energy for 1 mol of NADH = - 208 kJ (Negative sign indicates the release)Change in…
Q: HO CH2OH OH O OB anomer a anomer О ОН OH
A: We are given the structure of a monosaccharide. The monosaccharide is in a pyranose ring structure.…
Q: In the following reactions, identify the substance oxidized, the substance reduced, the oxidizing…
A: In some chemical reactions, there is transfer of electrons. The transfer of electrons from one…
Q: 2. If glyceraldehyde-3-phosphate dehydrogenase in red blood cells is completely inhibited, which…
A: Glyceraldehyde 3-phosphate dehydrogenase catalyzes the reversible reaction given…
Q: Of eight enzymes in the CAC, why is the succinate dehydrogenase complex unique? Because it is a…
A: Citric acid cycle, also known as Kreb's cycle or tricarboxylic acid cycle is an important metabolic…
Q: How does hydroxyurea therapy alleviate the symptoms of sickle cell anemia? (Select all that apply.)…
A: The question is about therapy that allevate the treatment for sickle cell anaemia, the hydroxyurea…
Q: The reaction below could be catalyzed by which main class of enzyme (Name and EC# provided)? HO HO…
A: Enzymes are the biocatalysts that are intended to catalyse the biochemical reactions by increasing…
Q: What are enzymes? What distinguishes enzymes from regular chemical catalysts? On the specificity of…
A: Enzymes are proteins that act as biological catalysts in living organisms.Enzymes are involved in a…
Q: What two 2° structures are highlighted (with the black circle) in this figure? The red amino acid…
A: The figure in the question depicts secondary structure conformation of a protein. Secondary…
Q: In oxidative phosphorylation, a chemical agent that prevents the enzymatic activity of F1 would…
A: The correct answer is:c. 1 = Inhibit electron transfer; 2 = Inhibit ATP synthesis
Q: 11.68 Acetylene (ethyne) gas reacts with oxygen and burns at 3300 °C in an acetylene torch. (7.4,…
A: The balanced chemical equation for the complete combustion of acetylene (C₂H₂) can be written…
Q: Table 2 Absorbance vs CoCl2 concentration Test Tube Number Cobalt Chloride Concentration…
A: Spectrophotometry or colorimetry is an analytical technique that is used for the quantification of…
Q: Tost Mwt Stds, KD 272 132 95 || Non-denaturing Denaturing 11 - 66 - 45 14
A: Pyruvate carboxylase (PYC) is the enzyme that catalyzes the transfer of a carboxyl group to pyruvate…
Q: Why does FAHD2 oxidation give 1.5 ATP while NADH oxidation gives 2.5 ATP? Explain this in relation…
A: The differing entrance locations of NADH and FADH2 at which they contribute electrons in ETC,…
Q: When you ingest a pathogen in your diet, how can the you cope with it
A: After ingesting a pathogen, the body has a number of defence systems to deal with pathogens that are…
Q: Protein Avidin 1 Insulin receptor 2 Anti-HIV immunoglobulin 3 Nickel binding protein 4 Myoglobin 5…
A: Answer:Tabel:Protein Ligand kd(M)Affinity Source /OrganismInsulin-receptorinsulin 1-10…
Q: On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in the course of…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: Given the following biosynthesis scheme, answer the questions (a)-(c) below. OH Me C E Me Me SACP OH…
A: For the synthesis of unbranched fatty acids, living beings carboxylate Acetyl CoA to yield malonyl…
Q: Explain what proteins are and why they are important. Include essential, nonessential, and…
A: Amino acids are the building blocks of proteins, consisting of a central carbon atom bonded to an…
Q: Pyruvate dehydrogenase phosphatase is the regulatory component of pyruvatedehydrogenase complex.…
A: Pyruvate dehydrogenase phosphatase (PDP) is an enzyme that regulates the activity of pyruvate…
Q: is the end product of the citric acid cycle's regeneration phase.
A: The citric acid cycle—also referred to as the Krebs cycle or the tricarboxylic acid cycle—is a chain…
Q: What is the significance of a positive presumptive test?
A: Presumptive test is also known as a screening test. It is an initial or preliminary test that…
Q: 373. Which protein structure forms tight ß-sheets with alanine and glycine as major amino acids (a)…
A: The precise three-dimensional arrangement of amino acids within a protein dictates its function and…
Q: 19. Which of the following is true? A. Water molecules that surround a less polar molecule in…
A: The three dimensional structure of proteins are stabilized by non-covalent interactions like…
BIOCHEMISTRY
Which methodologies can be used to detect the expression of a given protein? Please provide pros and cons of each mentioned approach.
Step by step
Solved in 4 steps
- Mass spectrometry is a powerful tool in proteomics. What are the four key features of a mass spectrometer? Describe briefly how MALDI and two-dimensional polyacrylamide gel electrophoresis could be used to identify a protein expressed in cancer cells but not in normal healthy cells.What bioinformatic tools could applied to predicting protein structure or mine bioactive genes?BLAST searches and related applications are essential for analyzinggene and protein sequences. Define BLAST, describe basic features of this bioinformatics tool, and give an example of informationprovided by a BLAST search
- Explain how a target protein is separated from other cell proteins given a specific purification sequence.What is the name given to study of biochemical nature of genes and how genes express their encoded informationdiscuss using named examples some of the advantages and disadvantages of protein engineering using site directed and random mutagenesis
- Does lysyl-tRNA synthetase have a proofreading capability? If so, what are other amino acids can you predict that fit into the active site and may get hydrolyzeddiscuss using named examples some of the disadvantages of protein engineering using site directed and random mutagenesisDescribe the common strategy (steps) for protein sequencing, starting with a biological sample containing many cell and biochemical substances. How prevalent are disulfide links in proteins? Why do the disulfide links need to be broken prior to sequencing? How can they be chemically broken?
- Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…In Multi-Column Purification of rGFP. What happens to the protein amount, protein purity, and/or specific activity of a purification fraction if one of the three is changed? (i.e. understand the relationship between the three.)Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?