Which of the following DNA regulatory protein “motifs” consists of one a-helix and one b-sheet, linked by a zinc ion, and usually acting as a polymer of several monomers in the regulation of DNA? the homeo-domain the leucine zipper the zinc finger all of the above none of the above

Which of the following DNA regulatory protein “motifs” consists of one a-helix and one b-sheet, linked by a zinc ion, and usually acting as a polymer of several monomers in the regulation of DNA? the homeo-domain the leucine zipper the zinc finger all of the above none of the above

Name: Which of the following DNA regulatory protein “motifs” consists of one
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following DNA regulatory protein “motifs” consists of one a-helix and one b-sheet, linked by a zinc ion, and usually acting as a polymer of several monomers in the regulation of DNA?the homeo-domainthe leucine zipperthe zinc fingerall of

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 19P: Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite...

See similar textbooks

Similar questions

Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite activator protein (CAP). What kind of interactions do you suppose predominate, and what kinds of CAP amino acid side chains might be involved in these interactions?
Which of the following DNA regulatory protein “motifs” consists of three a-helices, in a single polypeptide, acting independently of other polypeptides in the regulation of DNA? the leucine zipper the zinc finger the homeodomain all of the above none of the above
Which of the following DNA regulatory protein “motifs” consists of three a-helices, in a single polypeptide, acting independently of other polypeptides in the regulation of DNA? the leucine zipper the zinc finger the homeodomain all of the above none of the above Which of the following processes regulates the maturation of mRNA from hnRNA (in the control of gene expression in humans and other eukaryotes)? translation of polypeptides self-replication of DNA processing of RNA transcription of RNA self-replication of RNA
The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries the information to make aregion of a polypeptide with the amino acid sequence, methionineglycine-leucine-serine. What would be the consequences if a mutationchanged the second cytosine (C) in this sequence to an adenine (A)?
Hydrogen bonds are important in DNA replication and transcription. They are relatively weak chemical bonds. Why is this a desirable feature for DNA? Describe the effect (s) of changing (mutating) the promoter on the transcription of the DNA strand/gene the promoter controls. What happens to protein synthesis if a nonsense codon is inserted into the gene? Explain why a point mutation does not necessarily change the original amino acid sequence. (Explain silent mutations) Choose any pentapeptide composed of five different amino acids. List the amino acids. Present one messenger RNA codon for each amino acids and the sequence of nucleotides on the DNA that originally coded for your pentapeptide.
A certain template DNA strand has the following nucleotide sequence: 3'—TACTGCATAATGATT—5' What would be the sequence of codons in the mRNA transcribed from this strand? What would be the nucleotide sequence of the complementary nontemplate DNA strand?
A DNA-binding protein recognizes the following double-strandedsequence:5′–GCCCGGGC–3′3′–CGGGCCCG–5′This type of double-stranded structure could also occur withinthe stem region of an RNA stem-loop. Discuss the structural differencesbetween RNA and DNA that might prevent the DNAbindingprotein from recognizing a double-stranded RNA molecule.
The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′
Which of the following histones bind to linker DNA?a) H1b) H2Ac) H2Bd) H3
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.