Which of the following are similar characteristics shared between DNA replication and transcription? Select ALL that apply. Polymerases that synthesize in the 5' 3' direction Simultaneous synthesis of two complementary nucleic acid strands Complementary base-pairing of nucleotides using a single-stranded DNA template Both processes require enzymes with helicase activity A-U and C-G base-pairing

Which of the following are similar characteristics shared between DNA replication and transcription? Select ALL that apply. Polymerases that synthesize in the 5' 3' direction Simultaneous synthesis of two complementary nucleic acid strands Complementary base-pairing of nucleotides using a single-stranded DNA template Both processes require enzymes with helicase activity A-U and C-G base-pairing

Name: I’m having trouble which characterizes the DNA replication and transcr
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: I’m having trouble which characterizes the DNA replication and transcriptions? Which of the following are similar characteristics shared between DNA replication and transcription? Select ALL that apply.Polymerases that synthesize in the 5' 3' directi

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
The proofreading function of DNA polymerase involves the recognitionof a ________ and the removal of a short segment of DNA in the __________ direction.a. missing base, 5′ to 3′b. base pair mismatch, 5′ to 3′c. missing base, 3′ to 5′d. base pair mismatch, 3′ to 5′
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. Withregard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrectpyrimidine instead of the correct pyrimidine (e. g. adding cytosine where thymine should be added) is called atransition. If a pyrimidine is incorrectly added to the growing strand instead of purine (e.g. adding cytosine when anadenine should be added), this type of mistake is called a transversion. If a transition or transversion is not detected by DNA polymerase, a mutation is created the permanently changes the DNA sequence. Though both types of mutations are rare, transition mutations are more frequent than transversion mutations. What are at least three explanations as to why this is the case?
Which of the following features is common to both DNA replication and RNA transcription? Both RNA and DNA polymerase form a sugar-phosphate bond between the 3' hydroxyl and the 5' phosphate. Both RNA and DNA polymerase require oligonucleotide priming. Both RNA and DNA polymerase incorporate deoxyribonucleotides into the growing sequence. Both RNA and DNA polymerase initiate at promoter sequences. Both RNA and DNA polymerase have extensive proofreading editing.
Which of the following statements is/are TRUE for both replication and transcription? Polymerase moves in the 3'- 5' direction. Polynucleotide chain grows from the 5' -3’ direction. Requires four nucleoside triphosphates and Mg2+. Polymerase catalyzes the synthesis of new strands.
The purpose of DNA gyrase in replication is: to relieve positive supercoiling induced by unwinding the DNA during replication. to induce tighter coiling in supercoils. to remove the RNA primers from the lagging strand at each Okazaki fragment to start unwinding and separate the DNA to initiate replication to provide energy to remove a diphosphate fragment from each nucleoside triphosphate.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
It is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helix