Answered: Which of the following is directly…

Name: Which of the following is directly responsible for catalyzing the syn
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following is directly responsible for catalyzing the synthesis of a complimentarysequence of DNA from the template strand?primersDNA ligaseTaq polymeraseO nucleotidesO MgCl2

Science

Biology

Which of the following is directly responsible for catalyzing the synthesis of a complimentary sequence of DNA from the template strand? primers DNA ligase Taq polymerase nucleotides MgCl2

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 18RQ: During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol...

See similar textbooks

Similar questions

During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
Which of the following is NOT true regarding E. coli replication on the lagging strand? initially synthesized as Okazaki fragments primers are removed by DNA polymerase I. synthesized discontinuously. performed in a 5'→3' direction of synthesis
Which of the following enzymes ensures that the correct base of a deoxynucleotide for growing the chain is aligned with template chain? DNA gyrases DNA ligases DNA polymerases primases
Which of the following steps is NOT part of a typical polymerase chain reaction? Choose an answer below: primer annealing ligation of DNA fragments by DNA ligase primer extension by DNA polymerase heat denaturation of double stranded DNA none of the above
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Which of the following enzymes at the bacterial replication fork hydrolyze ATP for their activity? (Select all that apply) DNA Ligase DNA Polymerase I DNA primase PCNA SSB DNA helicase DNA Polymerase III Clamp Loader
The 5’-ACTGCA DNA probe will hybridize with (stick to) which of the following DNA strands?a. 5’-TGACGTb. 3’-UGACGUc. 5’-GGCAAUd. 3’-TGACGTe. 5’-CCGUUA
Which of the following DNA pol I activities would be MOST important in the removal of the primer? ability to nick both strands of the DNA 5' to 3' exonuclease activity 3' to 5' exonuclease activity polymerase activity
Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates to the 3' OH of the growing daughter strand in the 5' - 3' direction? Ligase Polymerase Topoisomerase Primase
. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
Which of the enzymes from the following list wouldyou need to make a recombinant DNA molecule? Whatis the function of those enzyme(s) in the process?a. DNA polymeraseb. RNA polymerasec. A restriction enzymed. DNA ligasee. An aminoacyl-tRNA synthetasef. Peptidyl transferaseg. Reverse transcriptase