A cytosine deamination occurs in the top strand of the following DNA duplex 5'-gATTACA-3' 3'-CTAATgT-5' The duplex is then replicated before the deamination is repaired. What will be sequence of the newly synthesized bottom strand? Your answer should read 3' to 5'

A cytosine deamination occurs in the top strand of the following DNA duplex 5'-gATTACA-3' 3'-CTAATgT-5' The duplex is then replicated before the deamination is repaired. What will be sequence of the newly synthesized bottom strand? Your answer should read 3' to 5'

Name: A cytosine deamination occurs in the top strand of the following DNA d
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A cytosine deamination occurs in the top strand of the following DNA duplex5'-gATTACA-3'3'-CTAATgT-5'The duplex is then replicated before the deamination is repaired.What will be sequence of the newly synthesized bottom strand?Your answer should read

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates to the 3' OH of the growing daughter strand in the 5' - 3' direction? Ligase Polymerase Topoisomerase Primase
You have determined that the newly synthesized strand of DNA in your sequencing reaction has the sequence 5�-ACTACCGAGT-3�. What is the sequence of the template strand?
Fill in the blank. As helicase unwinds closed circular DNA, it compensates for positive supercoiling. The stress of this force must be overcome or the replication machinery will be unable to proceed. DNA gyrase, a bacterial __________, is the leading candidate for this role in coli.
Which repeating sequence below would you expect to find on the end of the longest DNA strand of a chromsome (select one)? A. 5'-TTTTTT-3' B. 5'-TTAGGG-3' C. 5'-CCCTAA-3' D. 5'-AAAAAA-3' E. 5'-GGATCC-3'
During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following sequences for the complementary strand? a. 5' GGCCTAT 3' b. 5' CCGGATA 3' c. 5' ATAGGCC 3' d. 5' TATCCGG 3'
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
DNA that has been labeled with 15N is used as the template for replication. Replication is carried using 14N labeled dNTP's. After 3 rounds of replication, what percent of DNA molecules have one strand containing 15N and one strand containing 14N? A. 50% B. 75% C. 25% D. 100%
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
A gene encoding one of the proteins involved in dna replication has been inactivated by a mutation in a cell. in the absence of this protein, the cell attempts to replicate its dna. What would happen during the dna replication process if each of the following proteins were missing?a. DNA polymerase B. DNA ligasec. Sliding clamp for DNA polymerased. nuclease that removes RNA primerse. DNA helicase F. primase