Which of the following functions are associated with the E. coli RNA polymerase? Select all that apply Helicase activity Topoisomerase activity 3' to 5' polymerase activity 5' to 3' polymerase activity
Q: Which of the following features is common to both DNA replication and RNA transcription? Both…
A: Nucleic acids, made up of nucleotide bases, as deoxyribonucleic acid (DNA) and ribonucleic acid…
Q: Which activity of E. coli DNA polymerase I is responsible for proofreading the newly synthesized…
A: The first known polymerase is the DNA Polymerase I. It is the enzyme that participates in…
Q: The following sequence of nucleotides is found in a single-stranded DNA…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: A pyrimidine dimer which is a bulky lesion has mutated an E. coli cell's DNA. Describe both the…
A: The DNA damage can be repaired by several mechanisms that includes direct repair, excision repair,…
Q: Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'
A: Transcription is a process in which one strand of DNA known as template strand is known as converted…
Q: DNA template A complementary DNA primer Single-stranded RNA template Four deoxynucleotides (DATP,…
A: Introduction:- The process of determining the sequence of nucleotides (As, Ts, Cs, and Gs) in a…
Q: Which of the following statements about base editing is correct? 1. It involves nCas9. 2. The end…
A: Base editing It is an alternative tool to HDR-mediated replacement. This facilitates editing of…
Q: 115. E.coli has only 4.6 ×10° base pairs and completes the process of replication within 18 minutes;…
A: The answer will be 2000 if the process of replication occurs within 38 minutes. So, the answer is…
Q: A cloned fragment of DNA was sequenced by using the dideoxy method. A part of the autoradiogram of…
A: Sanger sequencing, often called chain-termination sequencing, is a DNA sequencing technology…
Q: Which of the following is not a function of single-strand binding proteins? O prevents reformation…
A: SSBPs : Also called the single-strand binding proteins are a key component of the DNA replication…
Q: Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts…
A: DNA helicase is used during the DNA replication process where it binds to the double-stranded DNA…
Q: The schematic diagram below shows the functional organization of transcribing RNA polymerase. Match…
A: Transcription is the next step after replication in the central dogma of biology. It is the process…
Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?
A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: What is the directionality of the given process? Choices: 3'-5' ,5'-3' Exonuclease activity…
A: The direction of movement of different Enzymes in replication process makes it accessible to the…
Q: What is the following molecules not required for DNA synthesis during S- phase? * O RNA primer…
A: DNA replication is the process by which new DNA is synthesized from the old DNA. In case of…
Q: RNA polymerase Il promoters are located on the side of the template strand a. internal b. C-terminal…
A:
Q: Which of the following correctly describes a difference between RNA & DNA polymerases? RNA…
A: Transcription is the biological process of copying a segment of DNA into RNA, for example mRNA that…
Q: Consider prokaryotes, choose the CORRECT enzyme/keyword for the following function/role: Seals the…
A: DNA Ligase
Q: Which of the following is synthesized from a DNA template? (Select one) a. Transducer RNA b.…
A: The short stretch of DNA that serves as a functional unit of heredity is called the gene. The…
Q: In E. coli, RecBCD complex has (select all correct answers) endonuclease activity а. O b. DNA…
A: RecBCD is a enzyme of e.coli which is required to repair thier DNA. RecBCD has many components and…
Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…
A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…
Q: Consider the RNA sequence 5' AUGUUAGAUCGG 3' transcribed from the DNA molecule below. 1. 5'…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: Which of the following is FALSE regarding primase? It synthesizes primers on the leading and lagging…
A: Replication is the process during which DNA is replicated into the daughter DNA with the help of…
Q: Topoisomerases can cut phosphodiester bonds and the DNA ligases will have to seal the nicks whenever…
A: DNA ligases are enzymes that catalyze formation of a phosphodiester bond at a single-strand break in…
Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…
A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…
Q: An E. coli replication fork is shown in Figure 2.2. III 3' IV 5 II Figure 2.2 (i) Identify the…
A: The nucleic acid polymer has nucleotide as its monomeric unit. The synthesis of nucleotides is an…
Q: Which of the following enzymes remove supercoiling in replicating DNA ahead of the replication…
A: The DNA is in the form of a circular molecule. The DNA is right-handed helix and consists of some…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: Transcription is a process through which the template strand of DNA transcribes into mRNA to carry…
Q: The following strand is a template strand: 3'-АТСТАСССТТCGACTAGAАСААСТ-5' The non-template strand is…
A: DNA ( Deoxyribonucleic acid) is ladder like helical structure which act as genetic material in most…
Q: Define the following terms:a. DNAb. RNAc. double helixd. genomee. transcription
A: DNA : DNA is deoxyribonucleic acid. It is a long molecule which is made up of nucleotides .…
Q: Supercoiling of DNA requires GTP as source of energy is only observed in prokaryotes is…
A: DNA is a genetic material present in most living organisms. In case of eukaryotic cells DNA is found…
Q: Replication ends at a(h) Transcriptioh ends at alh) and Translation ends at a(n). O Poly-U or…
A: Answer is (c) Replication ends at ter site Transcription ends at Poly U / Hairpin loop Translation…
Q: An experiment is performed with Primase, using a specific DNA template. In this experiment, you…
A: Radiolabeled nucleotides are used for the detection of specific nucleic acid sequences. For…
Q: Which one of the following is true of DNA polymerase, based on our coverage? The 2'OH of the dNTP…
A: DNA is the genetic material of most of the organisms. DNA polymerase has important role in DNA…
Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…
A: CENTRAL DOGMA CONCEPTS DNA–>RNA–>protein
Q: Discuss the following statement: “primase is a sloppy enzyme that makes many mistakes. eventually,…
A: Enzymes are biocatalysts that aid in the speeding up of reactions. They are proteins that help to…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…
A: Answer
Q: The base composition of the transcribable DNA template is: A = 10% G = 40% C = 30% T= 20% %3D %3D…
A: Transcription is a process in which the information in a DNA template is copied to produce an mRNA.
Q: Which one of the following statements about restriction endonucleases is true? all restriction…
A: A restriction enzyme or restriction endonuclease is an enzyme that cleaves/cuts DNA into fragments…
Q: Below is a list of "solutions" to problems encountered when bacteria replicate DNA. Match the…
A: Enzymes are highly specialized proteins that act as a catalyst in the biological system, they are…
Q: Which of the following enzymes has the highest functional error? a) DNA Polymerase I b) DNA…
A: The proofreading activity of enzymes helps in reducing the number of errors. Proofreading activity…
Q: True or false double strand rna is synthesized using taq polymerase. plasmids are linear…
A: In biotechnology different techniques has been developed for the synthesis and identification of…
Q: Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features:…
A: Introduction: DNA polymerases are the group of enzymes that catalyze the synthesis of DNA strands…
Q: Which is the odd one out ? For the rest, explain the concept/process/technique they are involved…
A: Introduction Enzymes:- These are proteins that help speed up metabolism, or the chemical reactions…
Q: All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling…
A: DNA gyrase is the first type II topoisomerase discovered from E. coli. DNA gyrase has the ability to…
Q: Which of the following has activity that is most similar to RNA Polymerase? Helicase DNA…
A: RNA polymerase It is defined as the enzyme which is involved in copying the sequences of DNA into…
Q: Both function as holoenzymes that have polymerase and helicase activities Both bind promoters Both…
A: Characteristics shared by both RNA polymerase and DNA pol III in E.coli Statement A ) RNA Polymerase…
Q: Which of the following is NOT a function of DNA polymerase I in E. coli? Question 1 options: A) 5'…
A: Answer: C) Helicase
Q: Which of the following statements about polyadenylate polymerase is correct? O It is tethered to RNA…
A: Polyadenylate polymerase (polyA polymerase) adds polyA tail to the mRNA as a part of the…
Step by step
Solved in 2 steps
- Which is the odd one out ? For the rest, explain the concept/process/technique they are involved with. TFIIH TFIIF RNA polymerase II TFIIE EIF-2Which of the following statements is/are TRUE for both replication and transcription? Polymerase moves in the 3'- 5' direction. Polynucleotide chain grows from the 5' -3’ direction. Requires four nucleoside triphosphates and Mg2+. Polymerase catalyzes the synthesis of new strands.The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome assembly B. 5’→ 3’ polymerase C. 3’ → 5’ exonuclease and proof-reading D. sliding clamp
- Which of the following enzymes adds incoming deoxyribonucleotides/deoxyribonucleoside triphosphates to the 3' OH of the growing daughter strand in the 5' - 3' direction? Ligase Polymerase Topoisomerase PrimaseWhich of the following is/are required for RNA synthesis? (select all that apply) Divalent cations (e.g. Mg2+) DNA polymerase to synthesize DNA primers RNA polymerase to synthesize RNA primers dNTPsthe 3'____> 5' exonuclease activity of E. coli DNA polymerase III aacounts for the ____________ of polymerization A-Directionality B- processivity C-low error rate D-High speed
- A pyrimidine dimer which is a bulky lesion has mutated an E. coli cell's DNA. Describe both the photoreactivation enzyme repair (PRE) and Nucleotide excision repair describe how the cell uses Uvr A, B, C, D gene products to effect repair.Supercoiling of DNA requires GTP as source of energy is only observed in prokaryotes is not observed in eukaryotes requires the action of topoisomerasesA fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
- Which of the following are unique to RNA polymerase and not found in RDRP? (In other words not shared between the two. Select all that apply.) a) Double-stranded template b) DNA template c) NTP input d) RNA product. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that anOkazaki fragment is made from this segment, what will be the fragment’s sequence? Label its 5′ and 3′ ends. 5′.…CCTTAAGACTAACTACTTACTGGGATC….3′ 3′.…GGAATTCTGATTGATGAATGACCCTAG….5′Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'