Which of the following is not a similaritybetween prokaryotic initiation andeukaryotic initiation?a.GTP is required to releaseinitiation factors from theribosomeb. An initiation factor (IF1/elF1A)binds to the A siteС.MRNA binds before the binding ofIF2/elF2 at the P sited. Hydrolysis of GTP is part of therecruitment of the large ribosomalsubunit

Name: Which of the following is not a similaritybetween prokaryotic initiat
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Which of the following is not a similaritybetween prokaryotic initiation andeukaryotic initiation?a.GTP is required to releaseinitiation factors from theribosomeb. An initiation factor (IF1/elF1A)binds to the A siteС.MRNA binds before the binding of

GTP-binding proteins are important regulators of cell growth and differentiation, as well as…

Science

Biology

Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation? a. GTP is required to release initiation factors from the ribosome O b. An initiation factor (IF1/elF1A) binds to the A site O c. MRNA binds before the binding o IF2/elF2 at the P site O d. Hydrolysis of GTP is part of the recruitment of the large ribosoma subunit

Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation? a. GTP is required to release initiation factors from the ribosome O b. An initiation factor (IF1/elF1A) binds to the A site O c. MRNA binds before the binding o IF2/elF2 at the P site O d. Hydrolysis of GTP is part of the recruitment of the large ribosoma subunit

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter14: Gene Regulation

Section: Chapter Questions

Problem 6TYU

See similar textbooks

Similar questions

Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
Which of the following is characteristic of genes and gene regulation in both bacteria and eukaryotes? (a) promoters (b) non-coding DNA within coding sequences (c) enhancers (d) operons (e) DNA located in a nucleus
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
what is the first event to take place in translation in eukaryotic cell? a. An clongation of the polypeptide chain by the addition of amino acids b. Binding of the larger ribosomal subunits to the smaller ribosomal subunits c. Base pairing of activated methionine-tRNA to AUG of messenger RNA d. The small subunits of ribosome recognizing and attaching to 5' cap of mRNA
Prokaryotic cells can have more than one functional start codon per mRNA because There are multiple answers A prokaryotic promotes consist of two separated sequences: the -30 box and the -10 box B they make polycistronic RNA C both transcription and translation happen in the same cellular compartment D prokaryotic ribosomes bind to the Shine-Delgarno sequence E the activity of the lac repressor is regulated based on the physiologic condition of the cell
Which of the following is true of ribosome rescue? (C & E wrong) A. The process produces a protein that is tagged for degradation. B. Proteases enter the A-site of the ribosome to degrade the C-terminus of the synthesized peptide. C. A partially translated mRNA becomes fully degraded before it can be translated further. D. No protein is produced in the process. E. Stalled ribosomes are released in the absence of a stop codon.
Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA template
During the initiation stage of translation in bacteria, which of the following events occur(s)? a. IF1 and IF3 bind to the 30S subunit. b. The mRNA binds to the 30S subunit and tRNAfMet binds to the start codon in the mRNA. c. IF2 hydrolyzes its GTP and is released; the 50S subunit binds to the 30S subunit. d. All of the above events occur.
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’
what is the translation factors(s) most involved in decoding a) IF1,IF2,IF3 b) N-fMet-tRNAfMet and mRNA c) EF-Tu d) EF-G e) release factor and ribosome recycling factor
Microb an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysine
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein