Which of the following is true regarding the human genome? SİRNA prevents LINE element expansion by either degrading LINE MRNA methylating LINE DNA DN A :
Q: Which of the following enzymes is mainly responsible for recognizing the PAM sequence in the…
A: CRISPR (clustered regularly interspaced short palindromic repeats) sequences are found in bacterial…
Q: What is the correct order of the gene sequence given the following information: BD - 14% CD - 12% AD…
A: BASIC INFORMATION ABOUT GENETIC MATERIAL DNA It stands for deoxyribo nucleic acid. It is the…
Q: Which of the following mobile genetic elements is a retrotransposon, making up about 15% of the…
A: A transposon may be a nucleic acid sequence which will modify its position among a genome,…
Q: Which of the following is a transition mutation? OG --> T G --> A G --> C
A:
Q: Which of the following enzymes is mainly responsible for recognizing the PAM sequence in the…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: The base composition of the genetic material is the same in all the species present on earth. The…
Q: What is the sequence of the first 10 nucleotides of the transcript of this gene? 5' 3'
A: Transcription is mainly the process of making RNA from gene sequence and transcript is the product…
Q: Identify which mutagen is described by the following statement. Results to the formation of thymine…
A: Thymine dimer: a. It consists of two adjacent pyrimidine nucleotides, which are usually thymine…
Q: Which of the following is a mechanism to imprint genes? O A) Methylation of cytosine B)…
A: The epigenetic modifications involves DNA methylation. By this process the expression of genes…
Q: What molecules or structures are present in cell that might interfere with DNA extraction?
A: DNA extraction is a method used to purify DNA from a sample. Here seperation of DNA occur from…
Q: Which of the following types of mutations would be produced by repair of a CRISPR-targeted double…
A: Non Homologous End joining is described as the pathway required for the repairing of those double…
Q: What is the correct order of the gene sequence given the following information: AB - 13.2% BC - 6.4%…
A: Chromosomes contain genes. The order of genes is generally conserved in different organisms. The…
Q: Most of the eukaryotic genome consists of protein-coding genes Group of answer choices True False
A: It is composed of one or more linear DNA chromosomes. The amount of DNA varies from species to…
Q: All EXCEPT which of the following statements are evidence that DNA, and not protein, is the genetic…
A: In the past, it was known that organisms carry something that is passed on to subsequent…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: An enzyme produced from the bacteria which recognizes specific base sequence in DNA and cut the DNA…
Q: Which of the following is a transversion mutation Select 4 correct answer(s) OA --> T OC--> T C -->…
A: Point mutations The mutations that occur at single base nucleotides are called a base or point…
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: Which of the following process generates a new copy of the transposable element at a new location of…
A: Transposition is a DNA recombination reaction that results in the translocation of a discrete DNA…
Q: GENERAL DNA SEQUENCE 3' TAC CGC TTA CGT CTG ATC GCT 5'…
A: Introduction In most organisms, genetic material is stored in the form of DNA in every cell of the…
Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…
A: Since you have asked the multipart question, we will solve the first three questions for you. If you…
Q: ) Consider a reference genome with genes as follows: AGAGAGAG|AACAACAACAAC|GGGAAAGGGAAA gene 1 |…
A: In DNA sequencing, a read is considered as an inferred sequence of base pairs or base pair…
Q: The BLAST program begins with a particular genetic sequence anda. translates it into an amino acid…
A: Homologous genes have similar DNA sequences which emphasizes that the proteins encoded by these…
Q: Identify which mutagen is described by the following statement. Results to the deamination of…
A: Mutagens are substances that induces mutation. Chemical mutagens are certain chemicals that induces…
Q: Define the following terms: a. transfection b. replicative transposition c. composite transposition…
A: Note: Since you have posted a question with multiple subparts, we will solve the first three…
Q: What type of mutations are the most harmful to an organism? Select at least 2 answers Deletion…
A: Mutations are change produced in the structure of DNA. These changes can be introduced either due to…
Q: The picture below depicts an aberration in the process of genetic coding. Which of the following…
A: DNA replication is the process by which a new DNA is synthesized by using a parental DNA molecule.…
Q: Which of the following contain only the sequences required for transposition and the genes for…
A: Transposons are the DNA sequence which can change their position within the genome. It may be simple…
Q: A hereditary disease is inherited as an autosomal recessive trait. The wild-type allele of the…
A: Given Northern blot data:Wild type allele = 1250 nucleotides long and A 1020 nucleotide allele is…
Q: The human gene for hemophilia is on the X chromosome. Below is a pedigree from a family afflicted…
A: Hi, Thanks For Your Question. Answer : Correct Option Is b (20%) Explanation : P (III-7 Is…
Q: Which of the following mobile genetic elements is a retrotransposon, making up about 10% of the…
A: A transposon can be defined as the characteristic mobile genetic element. These elements can…
Q: The process in which completely unmethylated DNA becomes methylated is called a. maintenance…
A: The silencing of gene expression in some plants and eukaryotes is done by an important event known…
Q: Which enzyme is required for the movement in DNA-only transposons? Group of answer choices Reverse…
A: In early 1970s, a number of researchers including Peter Starlinger and James Shapiro, independently…
Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…
A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…
Q: Which of the following statements can be said about the enzyme telomerase? Select all the answers…
A: The correct answers are : Option 2 Option 3 Option 4.
Q: What is the correct order of the gene sequence given the following information: AD - 25% AB - 15% AC…
A: Linkage map distance is calculated just as for the two point cross, by calculating the percentage of…
Q: The base composition of the transcribable DNA template is: A = 10% G = 40% C = 30% T= 20% %3D %3D…
A: Transcription is a process in which the information in a DNA template is copied to produce an mRNA.
Q: Which of the following endonuclease removes a length of DNA between two telomere sequences?a)…
A: Endonucleases are the restriction enzymes which make cuts at a specific positions within the DNA.…
Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…
A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…
Q: Define the following terms:a. nonreplicative transpositionb. replicative transpositionc. composite…
A: Transposons are DNA (deoxyribonucleic acid) segments that have the internal property of movement…
Q: Repeated sequences can lead to many chromosomal rearrangements following of two repeats and (3…
A: Chromosomal rearrangements are alterations in the chromosome sequence which is majorly caused by…
Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…
A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…
Q: About 60% of the base pairs in the human genome are AT. If the human genome has 3.2 billion base…
A: The guanine and adenine are purine bases. These are composed of 5 and 6 sided ring. Thymine and…
Q: Define the following terms: a. nonreplicative transposition b. transposable element c. bacterial…
A: Horizontal gene transfer or lateral gene transfer is a genetic transfer method by which the genetic…
Q: A vector that can carry a large fragment of chromosomal DNA is aa. YAC.b. BAC.c. PAC.d. any of the…
A: Vector is a deoxyribonucleic acid (DNA) segment and a genetic tool which, is used to carry sequences…
Q: single strand binding proteins are important for this activity prevent replication of the ends of…
A: Single strand binding protein (SSB) are a type of protein found in both viruses and microorganisms…
Q: If transmission of genetic information from cell to cell is normally achieved by copying the…
A: Introduction: Nucleic acids are one of the major molecules comprised of a nitrogenous base, a sugar…
Q: Outline natural processes that can produce mutationsby damaging DNA.
A: DNA damage refers to any damage in the chemical structure of the DNA molecule whereas the mutation…
Answer question 23
Step by step
Solved in 3 steps with 1 images
- The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 40 options: LINE & SINE/Alu sequences LINE sequences & IS elements SINE & Alu sequences transposons & retrotransposons jumping genes & deletorsMatch each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…The two forms of Non-retroviral mobile DNA elements which are observable in huge numbers in the genomes of mammalian (incl. human) genomes are known as: Question 19 options: LINE & SINE/Alu sequences LINE sequences & IS elements transposons & LINE sequences transposons & retrotransposons SINE & Alu sequences
- DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & IIIBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & III
- several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AATTransposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that can beidentified rapidly by inverse _______
- The following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.Most variation between individual humans is in the form of ______________________. One of the basic types of genetic change called _________________________ may arise by recombination within introns and can create proteins with novel combinations of domains. Scientists and government regulators must be very careful when introducing herbicide-resistant transgenic corn plants into the environment, because if resistant weeds arise from __________________ then the herbicides could become useless. Families of related genes can arise from a single ancestral copy by _________________________and subsequent ________________________. divergence purifying selection exon shuffling single-nucleotide polymorphisms gene duplication synteny horizontal gene transfer unequal crossing-overA small section of bacterial DNA template (anti-sense) strand has the following nucleotide sequence: GTT GTC CAC TCGA mutation in the above sequence involved the deletion of a single base, leading to a shift in the reading frame of the gene, resulting in an incomplete protein. Which of the following gene sequences exemplifies the mutation described above? Select one: a. TT GTC CAC TCG b. GTT GAT CCA CT c. GT ATC CAC TCG d. ATT GTC AC TCG