Need help on biology homework. ZygoteWhat type of mutations are the most harmful to an organism?Select at least 2 answersDeletionSubstitutionInsertionDuplicationA thymine is changed to an adenine in one DNA codon which causes a pdisorder. Which statement explains how the change in the DNA codon le

Mutations are change produced in the structure of DNA. These changes can be introduced either due to…

Answered: What type of mutations are the most…

What type of mutations are the most harmful to an organism? Select at least 2 answers Deletion Substitution Insertion Duplication

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 13P: Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA...

See similar textbooks

Related questions

Q: Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two…

A: Sickle cell anemia is an autosomal recessive trait, in which the beta-chain of the hemoglobin gets…

Q: Mutations on chromosomes may affect proteins. These mutations may be__to the structure and function…

A: Chromosomes are filamentous bodies composed of DNA and histone proteins. DNA( deoxyribonucleic acid)…

Q: An alteration in the DNA from an CG base pair to a AT base pair is called a Select one: O a.…

Q: In the process of transcription

Q: Could you please confirm which stage question number 4 would be? (Substitution, insertion,

A: INTRODUCTION The mutation rate of an organism is defined as the probability that a change in genetic…

Q: Construct a table, concept map, or picture to summarize how base analogues, DNA-modifying agents,…

A: Table of mutations induced by base analogue ,intercalary agents and DNA modifying agents --…

Q: An viral enzyme that can be used to create complementary cDNA is DNA polymerase. reverse…

A: The genome of an organism is defined as the whole heredity information encoded in the genetic…

Q: In CRISPR genome editing technology, when the Cas9 protein cleaves the target DNA sequence, what…

A: The microorganism depends on multiple defense strategies that support them to resist viral attack.…

Q: Below is a DNA strand. We will call this the original strand, and you will transcribe and translate…

Q: Where does a restriction endonuclease cuts DNA?a) Ligation siteb) Recognition sequencec) Orid)…

A: Restriction endonucleases are enzymes that cut the DNA strand at a specific sequence. They are…

Q: Which of the following is a transversion mutation Select 4 correct answer(s) OA --> T OC--> T C -->…

A: Point mutations The mutations that occur at single base nucleotides are called a base or point…

Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…

A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…

Q: explain the following terms: genomics, mutations(variants) & proteomics

A: The genome is a cell's entire collection of genetic material. In humans, the genome is made up of 23…

Q: A point mutation that replaces a purine with another purine, or a pyrimidine with another…

A: Mutation is defined as the change in the sequence of the DNA molecule present in the nucleus of an…

Q: When DNA is copied, sometimes a mutation occurs where an incorrect, base pairing appears within the…

A: Introduction :- Two nitrogen-containing bases (or nucleotides) that join to form the DNA structure.…

Q: Which type of mutation produces the same protein despite a change in the DNA? A. nonsense B.…

A: The mutation is defined as an alteration or change in the nucleotide sequence of the organism's…

Q: Which of the following is synthesized from a DNA template? (Select one) a. Transducer RNA b.…

A: The short stretch of DNA that serves as a functional unit of heredity is called the gene. The…

Q: Which type of mutations are the least harmful to an organism? * O Duplication Substitution O…

A: Mutations are sudden changes in the DNA sequence and lead to several new characteristics in an…

Q: ____________ proliferate by cutting and pasting the original copy to another part of the genome,…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: What type of mutation caused Nicholas’s disease?a. frameshift b. missense c. nonsense d. insertion

A: Nicholas’s disease Nicholas’s disease is broadly known as the sickle cell disease. In this disease,…

Q: A mutagen that is a base analog isa. ethyl methanesulfonate (EMS).b. 5-bromouracil.c. UV light.d.…

A: The DNA is a genetic material- a polynucleotide chain made up of the long chain of A, T, G, and C.…

Q: When different individuals within a population have different numbers of restriction sites within…

A: Introduction: A restriction site in DNA is a group of 6–8 base pairs that a restriction enzyme…

Q: Which of the following is most likely to be a restriction enzyme recognition sequence? O AAAAAA O…

A: A palindromic sequence is a sequence of nucleic acids within double helix of DNA and / or RNA that…

Q: Point mutations affect. can be classified by Answer 1 Answer 2 Answer 8 in which nucleotide base…

A: Mutations are the result of a change in the genetic code of an organism. It can occur DNA or RNA or…

Q: Which of the following mutagens can substitute bases in DNA because of structural similarity?…

A: A mutagen is defined as any physical or chemical substance that can cause a mutation by altering an…

Q: A ______________ mutation results from exposure to toxic chemicals (mutagens).

Q: Below is a DNA strand. We will call this the original strand, and you will transcribe and translate…

A: Transcription is the process in which mRNA is synthesized from DNA . This process takes place inside…

Q: Fill the Table with mutagenic agents and provide their type (physical, chemical, biological) and…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: Which type of mutations are the least harmful to an organism? O Duplication O Substitution O…

A: Mutations are the sudden changes of DNA sequence and lead to several new characteristics in an…

Q: Which kind of chemical damage is depicted in this picture: 2-OH strand breakage base deletion base…

A: Genome is a dynamic substance in nature. There are many physical and chemical agents which has the…

Q: A transposable element or sequence of DNA that can move within the genome Group of answer choices…

A: Transposable elements or sequences of DNA that can move within the genome are also called jumping…

Q: Insertion or removal of one or two nucleotide base pairs in a protein coding region of DNA usually…

A: Frameshift mutation is defined as insertion or deletion of a number of nucleotides that is not in…

Q: List two specific causes of DNA mutations. - environmental agents like ultraviolet light or…

A: A mutation is a change in the sequence of DNA which can result from DNA copying mistakes made during…

Q: Frameshift mutations can be caused by: strand slippage. O deletions. depurinations. intercalating…

Q: Identify which mutagen is described by the following statement. Inserts between adjacent bases in…

A: Certain chemical mutagen can insert between adjacent base pairs of DNA molecule e.g., proflavine…

Q: Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding…

A: Introduction:

Q: For each set: in 1-2 sentences define the term (a) Nucleotide substitution, deletion, insertion

A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…

Q: A transversion mutation would be replacing T by: a. C b. T c. either A or G d. U

A: Transversion mutation is a type of substitution mutation. A gene mutation that results from the…

Q: what is the Compares and contrasts transformation, transduction, and conjugation

A: In transformation, a bacterium takes up a piece of DNA floating in its environment. In transduction,…

Q: Mutations can be caused by which process? faulty DNA repair nondisjunction base sequence…

A: Mutation is defined as any heritable change in the genetic makeup of an individual. It is a sudden…

Q: Which of the following mutagens results in the deamination of nitrogenous bases? O nitrous acid base…

A: The amino bases adenine and cytosine lose one amino group when they are oxidised. As a result, in…

Q: What type of mutations are the most harmful to an organism? Select at least 2 answers Duplication…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: Which of the following single-stranded DNA molecules may possibly be a restriction enzyme target cut…

A: Restriction enzymes are specific endonuclease that are responsible for cutting double standard DNA…

Q: If a restriction endonuclease recognizes and cleaves a linear piece of DNA at 5 distinct places, how…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Define the following terms: a. nonreplicative transposition b. transposable element c. bacterial…

A: Horizontal gene transfer or lateral gene transfer is a genetic transfer method by which the genetic…

Q: Which type of DNA mutation can be passed on to the next generation? a. Gamete mutation b. Somatic…

A: 1) The genome of an organism is one of the most important components that are responsible for…

Q: which of the following statements accurately describes genetic mutations

A: 1. Mutation are natural process that increases genetic diversity. 2. Mutation in GAMETES will be…

Q: insertions

A: Any change in the DNA sequence of an organism is called a mutation. Mutation can be of different…

Q: Most genetic mutations are __________ to an organism. Question 7 options: A) detrimental beneficial…

A: Mutations are changes in the nucleotide sequence of DNA. These are of different types and can be…

Concept explainers

Intelligence

Intelligence refers to the intellectual functioning that compares a person's intelligence quotient (IQ) with other people of the same age. In other words, it is the ability to understand circumstances or situations and arrive at appropriate solutions. Both animals and plants exhibit intelligence.

Question

Need help on biology homework.

Zygote
What type of mutations are the most harmful to an organism?
Select at least 2 answers
Deletion
Substitution
Insertion
Duplication
A thymine is changed to an adenine in one DNA codon which causes a p
disorder. Which statement explains how the change in the DNA codon le

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Not all proteins are made from the RNA genome ofbacteriophage MS2 in the same amounts. Can you explainwhy? One of the proteins functions very much like a repressor,but it functions at the translational level. Which protein is itand how does it function?
Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a.) AGC (ser): ________b.) UGU (cys): ________c.) GGC (gly): _______d.) UGA (stop): _______e.) UUC (phen): _______
What is it about the endonucleases that prevents bacteria fromdestroying their own DNA? Using nucleotide letters, show thekind of cut that could be made on a DNA molecule to circularizeit into a plasmid.
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT
If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeats
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
What kind of mutation normally has no consequence? please explain the answer a.transversions b.insertion c.silent d.nonsense
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or functionis being affected by each mutation.(a) Newly synthesized DNA contains many mismatchedbase pairs.(b) Okazaki fragments accumulate, and DNA synthesis is nevercompleted.(c) No initiation occurs.(d) Synthesis is very slow.(e) Supercoiled strands remain after replication, which isnever completed.
What is the DNA (template) strand of the following DNA (coding) strand: CAGGATGAATTGCTC