Q: What are the three reactions catalyzed by PLP? Just name them.
A: Pyridoxal phosphate (PLP) refers to a coenzyme present in a variety of reactions and it is the…
Q: Define the term up-regulation?
A: The smallest unit of life is the cells. Every cell has cellular receptors, either inside it or on…
Q: List two ways in which glutathione functions in red blood cells.
A: Glutathione is a tripeptide which means it is composed of three amino acids, namely- glycine,…
Q: What is the mechanism of chymotrypsin catalysed by enzymes without cofactors?
A: CHYMOTRYPSIN is a digestive enzyme of pancreatic juice acting on the duodenum where it performs…
Q: In what general ways is balance of Ca21 achieved in the blood?
A: Calcium is of crucial importance in our body. It has several roles to play such as- Contraction…
Q: Why does the enzyme reaction for chymotrypsin proceed in two phases?
A: Enzymes are the biocatalysts that increase the rate of biochemical reactions happening inside the…
Q: Which are the two Sources of Cytosolic Ca21+?
A: Cell signaling allows cells to receive and respond to the surrounding signals. This is mediated by…
Q: Explain Cofilin
A: Actin is an essential component of microfilaments. It is a multi-functional globular protein that…
Q: What is Cohesin Complex?
A: DNA ( deoxyribonucleic acid) is the genetic material that the organism inherits from the parental…
Q: Define the term Allosteric Modulation?
A: The word, Allosteric, is derived from the Greek language in which Allos meaning 'other' and stereos…
Q: Describe allosteric regulation.
A: Numerous biochemical reactions occur simultaneously in a biological cell. The enzymes are the…
Q: Why is the overall coupled reaction exergonic?
A: The coupled reaction like a redox reaction which is coupled or combined.
Q: through cell membranes, explain why all cell types are not sensitive to the presence of 17 beta
A: 17 beta estradiol is formed in the ovaries, testes or adrenal glands. It is made from cholesterol.
Q: Different Types of Regulation require by Catabolic and Anabolic Pathways?
A: Catabolic pathway: It refers to the series of reactions that requires degradation of complex…
Q: The following molecule is required for the activation of uridylytransferase A. Glycine B.…
A: Apoenzymes are not functionally active while coenzymes are organic nonprotein molecules that bind…
Q: One of the blocking solutions that is traditionally used is non-fat milk, but this is not…
A: A phosphoprotein is a protein that has a single phosphate group attached to it, or a complex…
Q: Which of the following is false about chymotrypsin? A Hydrolytic cleavage of a peptide bond by…
A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…
Q: H,N NH, NH H;N он
A: Trypsin is a serine protease that cleaves the carboxyl-terminal of arginine /lysine and the amino…
Q: Which Factors alter the cytosolic Ca21 concentration?
A: Answer: Introduction: In contrast to extracellular fluid, cytosol consist of a high concentration of…
Q: Why is the regulation of metabolism through the control of enzymeactivity an extremely complex…
A: Metabolism refers to the formation and degradation of molecules in the body. The formation is known…
Q: What is the difference and similarities between CPT and HCPCS?
A: Note- This is not a nursing question and should not be posted under the nursing category. Current…
Q: Carbon monoxide competes with hemoglobin for 02 binding, resulting in toxicity. Is it possible that…
A: Aerobic cellular respiration, which needs oxygen, may provide energy. All of a live system's…
Q: Which of the following amino acid residues would not participate in general acid-base catalysis? A.…
A: Acid-base catalysis is the reaction mechanism that deals with the transfer of a proton from one…
Q: The binding of a _______________ and its __________________ initiates the particular event or series…
A: The binding of a ____LIGAND___________ and its ______RECEPTOR____________ initiates the particular…
Q: Name the four major marcomolecules with their subunits.
A: The macromolecules are the biopolymers and large non-polymeric molecules present in the biological…
Q: Why is it reasonable to expect that control can be exerted near the end of a pathway as well as near…
A: The biochemical pathways comprise a wide variety of control mechanisms at many organizational…
Q: Which one of the following Metal:Ligand ratios would NOT support reversible binding of the O2 ligand…
A: Asked : Metal ligand bond that doesn't support reversible binding.
Q: What is up-regulation, and what may cause it to occur?Give an example of up-regulation in the body
A: An increase within the range of receptors on the surface of target cells, creating the cells…
Q: A mutant form of polypeptide hormone angiotensin II has the amino acid composition (Asp, Arg, Ile,…
A: Introduction: The amino acids are combined by an amide or peptide bonds. The series of amino acids…
Q: In humans the purine ring cannot be degraded. How is itexcreted? What reactions are involved?
A: Purine is a heterocyclic aromatic organic compound that consists of two rings. It is water-soluble…
Q: In the following figure, one of the following statements is FALSE: With inhibitor
A: Vmax is the maximum velocity of an enzyme-catalyzed reaction. Km is the substrate concentration…
Q: Name the anabolic pathway that synthesizes fatty acids.
A: Fatty acid synthesis is the important anabolic pathway in most organisms which involves de novo…
Q: How are H^3 peptides used to study intracellular pathways?
A: A chain of reactions that transmits signals from the cell surface to intracellular targets. This…
Q: Which of the following amino acid residues cannot play a role in acid-base catalysis? a. Aspartate…
A: Acid-Base Catalysis is reaction process involving the movement of a proton from one molecule to…
Q: An increase in HDACS can lead to which of the following?
A: Ans - D) All of the above Chromatin's fundamental structure is known as nucleosome and it consists…
Q: What would be the effect of adequate concentration of AMP andGMP?
A: AMP: Adenosine Monophosphate GMP: Guanosine Monophosphate
Q: Which of the following amino acid residues would not provide a side chain for acid- base catalysis…
A: Introduction: Nearly one-third of all known enzymes require metal ions for the catalytic activity…
Q: What are the thioesters in the reaction catalyzed by PDH complex?
A: Thioesters in the reaction catalysed by PDH Complex are : Acetyllipoamide AcetylCoenzyme A
Q: Methicillin cannot be destroyed by because
A: Methicillin is a narrow spectrum beta-lactam antibiotic. It is used in laboratory to test the…
Q: What is the source of Inositol trisphosphate (IP3)?
A: Second messengers are molecules that are primarily responsible for relaying the signal received by…
Q: Define the following terms: a. coenzyme A b. TPP c. lipoic acid d. PDHC e. PDK1
A: Since you have posted a question with multiple subparts, we have been instructed to answer the first…
Q: Define the following terms:a. transsulfuration pathwayb. cystathioninec. homocysteined. PAPSe.…
A: Amino-acids are the important component of our body as the proteins which play various roles in our…
Q: What amino acids can be found in chymotrypsin’s specificity pocket? What would happen if one of…
A: Chymotrypsin is a proteolytic enzyme.
Q: Name two conditions in which the enzymes involved in the TCA cycle might be inhibited.
A: The TCA cycle is the part of cellular respiration that generates energy via the oxidation of acetate…
Q: The name of the molecule that is the substrate for PLC is
A: PLC is Phospholipase C - cleaves Phospholipids.
Q: Chymotrypsin preferentially binds the transition state. What is meant by that?
A: Transition state is free energy maximum state. It is an intermediate stage of enzyme-catalyzed…
Step by step
Solved in 3 steps
- Q: on Transcription process Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.Q1 There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ. b) Hypothesize the transcription of eukaryotic genes using prokaryotic promoter with further explanation.I. The retinoic acid receptor (RAR) is a transcription factor that is similar to steroid hormone receptors. Thesubstance (ligand) that binds to this receptor is retinoicacid. One of the genes whose transcription is activatedby retinoic acid binding to the receptor is myoD. Thediagram that follows shows a schematic view of theRAR proteins produced by genes into which one oftwo different 12-base double-stranded oligonucleotides had been inserted in the ORF. The insertion site(a–m) associated with each mutant protein is indicatedwith the appropriate letter on the polypeptide map.For constructs encoding proteins a–e, oligonucleotide 1(5′ TTAATTAATTAA 3′ read off either strand) wasinserted into the RAR gene. For constructs encoding proteins f–m, oligonucleotide 2 (5′ CCGGCCGGCCGG 3′)was inserted into the gene.NH2 f g h i j k l m COOHa b c d eThe wild-type RAR protein can both bind DNA and activate transcription weakly in the absence of retinoic acid(RA) and strongly in RA’s presence. Each…
- TACTCACCCCGTATTACGTTT What’s the MRNA Protein PhenotypeA cloned gene fragment contains a regulatory element that isrecognized by a regulatory transcription factor. Previousexperiments have shown that the presence of a hormone resultsin transcriptional activation by this transcription factor. To studythis effect, you conduct an electrophoretic mobility shift assayand obtain the following results: Explain the action of the hormone.Q1/ There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ. c) Although eukaryotic and prokaryotic RNA polymerases are homologous to one another, defend the unsuitable use of prokaryotic RNA polymerase for transcription of eukaryotic gene.
- Task #1 Mc1r alleles: In Florida Gulf coast mice, there are two different alleles of the Melanocortin Receptor (Mcr1) gene. The sequence for both alleles is shown below. This is an internal segment of the coding (non-template) sequence of the Mcr1 gene. The reading frame is set and you do not need to find an AUG. M allele 5’...ATC ACC AAA AAC CGC AAC CTG CAC TCG... m allele 5’...ATC ACC AAA AAC TGC AAC CTG CAC TCG... A. Compare these two allele sequences and circle the nucleotides that are different. B. Do you think this change will cause a shift in the codon reading frame? Why or why not? C. Do you think that this change will cause an early stop in translation? Why or why not? Task #2 Flow of information: A codon table is provided above. The 5’ codon nucleotide is in the left column, and second codon nucleotide is on top. The Mcr1 M and m allele sequences are shown again in the central dogma grids below with the reading frame designated. Fill in the grids. In the second column…A scientist compares the promoter regions of two genes. Gene A’s core promoter plus proximal promoter elements encompasses 70bp. Gene B’s core promoter plus proximal promoter elements encompasses 250bp. Which of the scientist’s hypotheses is most likely to be correct? More transcripts will be made from Gene B Transcription of Gene A involves fewer transcription factors Enhancers control Gene B’s transcription Transcription of Gene A is more controlled than transcription of Gene B.Hello, I am studying for an exam. I am having to understand this part of the chapter. I am working on TRANSCRIPTION & TRANSLATION. I need help answering 19-29? Do I only need 5 to 7 sentences? This is not work graded. What is RNA? How does the structure of RNA differ from that of DNA? In all DNA, regardless of source, length, etc. A=T and G=C. Why, in RNA, does A≠U and G≠C? Where in the cell does DNA transcription occur? What are the key stages of the process? What portions of the DNA does a cell use for transcription to make an RNA molecule? Once the cell has produced a new RNA molecule, what does it do with it? What major types of RNA are produced in cells? How do they differ in Unit 1 Study Questions processing, final location in the cell function, and whether or not they are a final or intermediary gene product How does the sequence of nucleotides in mRNA code for the sequence of amino acids in a protein? Why is the RNA code for the amino acids called a…
- GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotypeQ5 /Early termination via premature transcriptional termination (PTT) provides another level of transcriptional control. TSS is known to be caused by high accumulation of RNA Polymerase II depending on the action of NEF (negative elongation factor) and DSIF (DRB sensitivity- inducing factor). Evaluate factors that may contribute to high accumulation of RNA Polymerase II as mentioned earlier.15. differntial splicing allows a single gene to produce multiple proteins true or flasev
