Answered: Briefly describe the differences in the…

Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 5SQ: Mechanisms that govern gene expression do not operate during ___ . a. transcription b. RNA...

See similar textbooks

Related questions

Q: What makes it possible to correctly start translation from an mRNA having multiple codons for…

A: Methionine is the amino acid which codes for AUG codon usually.Translation is the process in which…

Q: dsRNA ...

A: Q. Double-strand RNA (dsRNA)________ Answer. Recognized by dicer.

Q: - Fraumeni Syndrome (LFS) is a rare hereditary cancer disease due to a mutation in the TP53 gene.…

A: P53 is a transcription factor and is a tumor suppressor protein synthesized by tp53 gene. P53…

Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…

A: Transcription: The process of synthesis of mRNA transcript from double stranded DNA template by the…

Q: which of the following statements is correct? A proteins make MRNA which then makes genes B genes…

A: Protein synthesis is the essential metabolism occurring in all livings; proteins are made from…

Q: II. Discuss the following aspects of transcription: 1. What is meant by monocistronic or…

A: Transcription has three phases: initiation, elongation, and termination. In eukaryotes, RNA…

Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…

Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…

A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…

Q: Define the Post-translational modifications. ?

A: Post-translational modifications also PTMs are changes made to protein after synthesis and are…

Q: Describe the process of transcription, focusing on the role of RNA polymerase, sigma (σ) factors,…

A: Transcription is a process of transcribing the template DNA into complementary mRNA sequence which…

Q: 29) Which one of the following statements about RNA processing is correct? A) Exons are cut out…

A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…

Q: Review after transcription modification. Match the term and its description. Each term can only be…

A: The process of converting a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: B-If a cell capable of de novo synthesis of purine-based nucleotides and has excess amounts of AMP…

A: GMP and AMP are synthesized from the precursor IMP. Aspartate reacts with IMP and forms…

Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…

A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…

Q: Q28. Which of the following is a sequence that would be likely to be bound by a transcription…

A: Transcription factor: To initiate transcription, eukaryotic RNA polymerase requires the help of…

Q: How 6mA controls gene expression ?

A: 6mA is N6-Methyladenine that has epigenetic roles in DNA (deoxyribonucleic acid) modification in…

Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: examples of how RNA secondary structure and catalytic RNAs are important in gene expression

A: The secondary structure of RNA consists of a single nucleotide. RNA folds between complimentary…

Q: a. Explain each of the three primary processes involved in mRNA processing in detail.

A: RNA splicing It is a form of RNA processing in which a newly made precursor mRNA is transformed into…

Q: Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to…

A: transcription is the process by which dna molecules are used as template to form new messenger rna…

Q: How does the sequence of the primary transcript resemble the sequence of the gene encoding it?…

A: The primary mRNA transcript is practical as soon as it's far synthesized. This is visible when…

Q: Explain about Formation of the RNA Polymerase II Transcription Initiation Complex ?

A: The process of transcription (synthesis of RNA from DNA) is initiated when RNA polymerase binds to…

Q: 1. Which of these activities occur in ER? You can select more than one. Transcription Translation…

A: Endoplasmic Reticulum- It is the largest single membrane- bound intracellular compartment or…

Q: Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are…

A: mRNA (messenger RNA) is a single-stranded molecule found in all of our cells. It transports the…

Q: B. What is different about the way in which these two DNA sequences increase the rate of…

A: The Catabolite activator protein (CAP) in E.coli activates transcription at more than a hundred…

Q: Why aren't ssb proteins necessary in transcription?

A: central dogma of molecular biology suggests the flow of biological information from dna to rna to…

Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev

A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…

Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…

A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…

Q: Briefly describe three stages of transcription. How is transcription initiated? How is…

A: Transcription the process in which RNA is formed from the DNA that is present in the nucleus of the…

Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…

A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…

Q: Describe the three phases of transcription. Be specific for full credit.

A: Transcription is completed in to three states... 1. Initiation of RNA chain formation 2. Elongation…

Q: a- What is genome assembly?

A: Sequence assembly is the process of matching & combining segments from a larger DNA sequence in…

Q: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial…

A: # According to our guidelines we can answer only first 3 subparts or in case of short type questions…

Q: NCREASED/DECREASED transcription of target genes. Select one: O a. Decreased ; Decreased O b.…

A: GTPase-Activating Proteins or GAPs act by binding to the GTPase. This enhances the hydrolysis of…

Q: 23 Which of the following statements about mutations are true?

A: The mutation is defined as a sudden, inheritable change in a DNA sequence. The process includes the…

Q: D) the transcription rate is very, very low

Q: In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In…

A: The process in which the information is stored in the DNA and transferred to an mRNA by the process…

Q: B. Briefly describe/summarize what happens in Transcription (focus on the enzymes necessary for each…

A: The replication of DNA is semi-conservative and depends on complementary base pairing.…

Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…

A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…

Q: Describe missense and nonsense mutations and how they are different from frameshift mutations.

A: Mutations can be defined as changes in the DNA sequence. It can result from errors in replication or…

Q: 5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3' mRNA: original protein

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Explain alternative splicing Please explain in 5 sentences or less, thank you

A: Gene expression can be defined as the process that uses gene information for the synthesis of a…

Q: shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…

A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…

Q: Review after transcription modification. Match the term and its description. Each term can only be…

A: In humans, each cell's nucleus contains 3 109 base pairs of DNA dispersed among 23 pairs of…

Q: Define both transcription and translation. In addition, describe the role(s) of each of the…

A: The two main steps involved in protein synthesis are transcription and translation. These two…

Q: iii) What does the mutation do to the TMEM16F protein? splicing is unaffected, truncated protein…

A: * Canine Scott syndrome is an inherited blood clotting disorder found in dogs. *dogs with this…

Q: Describe Duchenne muscular dystrophy (DMD) including its cause and symptoms. Then, explain why DMD…

A: Muscles are important to provide mechanical strength to the body. The skeletal muscles associated…

Question

100%

Q: on Transcription process Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

PLEASE HELP! Please use the following terms and describe how each works to control protein expression. - Chromosomal level- Transcription- mRNA transcript- mRNA degradation- Translation blockage- Protein degradation
Need help. Contrast DNA replication with gene expression (transcription→translation)—when does each occur? What molecules are involved? How much of the DNA is utilized?
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
15. differntial splicing allows a single gene to produce multiple proteins true or flasev
Need help to understand splicing and alternative splicing in cancer.
17. options are: transcriptional, post-transcriptional, post-transational
What are the functional consequences of this deletion for lilP mRNA transcription and translation? Motivate your answer (100 words max.)
choices: functional, no transcription, nonfunctional
How gene expression is controlled? (min 500 words)
Q.4:Describe the main players involved in the process of translation. proper explanation and diagram
Describe how genome-wide association studies have led to new understandings about the structure and function of the genome.
Explain the process of transcription, including the location, processes, and molecules involved.