Which of the following statement iscorrect?Chromophores are groupsconnected to each other and causecertain types of molecularabsorptionBathochromic shift can change thewavelength to be shorterHyperchromic effect leads to longerwavelength.NoneAuxochromes are groups adjacent toeach other but do not affect theenergy levels.Hypsochromic effect leads to longerwavelength,All

UV-Visible spectroscopy: This spectroscopic method belongs to absorption spectroscopy for…

Answered: Which of the following statement is…

Which of the following statement is correct? Chromophores are groups connected to each other and cause certain types of molecular absorption Bathochromic shift can change the wavelength to be shorter

Chemistry: Principles and Reactions

8th Edition

ISBN:9781305079373

Author:William L. Masterton, Cecile N. Hurley

Publisher:William L. Masterton, Cecile N. Hurley

Chapter23: Organic Polymers, Natural And Synthetic

Section: Chapter Questions

Problem 29QAP: For alanine, Ka1=5.1105,Ka2=1.81010 . Calculate the ratios [Z]/[C+] and [Z]/[A+] at pH (a) 2.00. (b)...

See similar textbooks

Related questions

Q: 5) When you consider the voltammetric techniques, how is polarography different than the others?…

A: 5. THE SHAPE OF THE POLAROGRAPHY IS OF SIGMOID SHAPE IT IS ELECTROANALLY TECHNIQUE THAT IS APPLIED…

Q: that absorbs at the wavelength of analysis will not obey Beer Lambert’s law. In uv-vis…

A: Following are the true and false statements with correct solutions.

Q: 50 uL of an aqueous sample of double-stranded DNA is dissolved in 950 uL of water. This diluted…

A: GIVEN Absorbance (A) =0.326 at 260 nm Molar Absorbivity (ε) = 0.020 ng-1mL Wavelenght (λmax ) =260…

Q: ography (a) Derive the relationship between diffusion analyte current and concentration of an in…

Q: What does it mean when a substance has low molar absorptivity? The substance has low transmittance.…

A: Molar Absortivity means how strongly a chemical species absorbs light at particular wavelength that…

Q: Give the functions of the following ingredients, then name a branded/commercial skin or hair care…

A: 1) Ozokerite wax = Ozokerite was is made of paraffin hydrocarbons. It is used in the beauty products…

Q: Though caffeine absorbs light, yet it is colourless. Why? How do the samples look like in following…

A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: [Ti(H20)6]SO4 has a CFSE of.. a. -1.2A+1P b. -0.8A+0P С. +1.2A+0P d. -1.6A+1P

A: In this question, we have to find out the correct answer of given problem by the help of the…

Q: Which parameter between "solvent polarity function" and dielectric constant show better correlation…

A: A higher dielectric constant of a solvent indicates higher ability of the solvent to dissolve salts.

Q: What are some of the factors that can make interpreting IR spectra more difficult and that should be…

A: In a molecule, especially in the organic compounds, the bonds present in the molecules exhibit…

Q: what are the applications of Atomis Force Microscopy and explain each

A: Atomic force microscopy (AFM) is a sub-nanometer scale resolution that has surface scanning…

Q: If absorption happens equally across all wavelengths then a transparen material appears colorless.…

A: Two questions based on physical chemistry, which are to be accomplished.

Q: A compound Y (150.0 g/mol) in a 1.00 cm quartz cell has an extinction coefficient (ε) of 23,150 at…

A: Because, the maximum wavelength (λmax) is known to us. Therefore, to calculate the energy(E)…

Q: You are given the following data : Peak order (n)…

A: Given: Peak order (n) Diffraction Angle (2q) 1…

Q: a) A current path shaped as shown in Figure produces a magnetic field at P, the center of the arc.…

A: Given, Current in the wire, I =2 A Angle of the arc, Ө = 30o Radius of the arc, R = 0.4 m Magnetic…

Q: 7000 6000 5000 4000 3000 2000 1000 0- 500 1000 1500 2000 2500 3000 3500

A: The FT-IR spectra is normally observed as transmittance vs wavenumber (cm-1). Here, the graph is…

Q: important is it to embed the 'emitter recoilness emission of a Y-ray. How The Mossbauer effect…

A: Emitter nucleus is embedded in a bulky, rigid crystal lattice to ensure that energy don't get lost…

Q: What are the different tetrabasic forms of EDTA? Describe their individual reactivities.

A: The structure of EDTA: EDTA (Ethylenediaminetetraacetic acid) is an amino polycarboxylic acid. The…

Q: IUPAC and the omega-nomenclature of LCDs

A: Answer - Omega-nomenclature - The Omega Nomenclature is almost exactly the same as the Delta…

Q: Define the term SDS page.

A: The term SDS page has a full form Sodium dodecyl sulphate. The term belongs to electrophoresis.…

Q: What are the meaning of IR drop, Overpotential and polarization?

A: answer- IR drop - the voltage drop due to energy losses in a resistor. IR drop is the electrical…

Q: The polarity of silica gel (stationary phase) is low. Select one: O True O False

A: In chromatography, we use a stationary phase, and one mobile phase. The stationary phase must be…

Q: analysis of a compound not distinguish between a monomer and dimer of the species? What technique…

A: Monomer is relatively small molecule, they can be binded covolently to other monomer to form…

Q: Which of the following IR bands would you expect for N(CH3)3? O 2 Spikes at around 3400 cm1 O none…

A: IR spectroscopy is an important tool for detecting the functional group in the unknown organic…

Q: Find the isoelectric and zwitter ion of lysine

A: isoelectric point means the characteristic pH at which net effective charge of an amino acid is…

Q: Calculate the wavenumber of the C-Cl band in CCl4.

A: the wavenumber of C-Cl bond in CCl4 is calculated using the formula: ν' =1/2πck/μ where k=force…

Q: There is a substance in a solution (4 g/liter). The length of cuvette is 2 cm and only 50% of the…

A: The Beer-Lambert law can be expressed as follows for a solution of concentration C and length of…

Q: What is piezoelectricity? short discription

A: The pizoelectricity concept was put forward by Paul-Jacques Curie and his younger brother Pierre,…

Q: 10. In what ways can a refractive index be used to characterize a liquid sample? 11. Describe how to…

A: A question based on properties of liquids that is to be accomplished.

Q: Dotougite the Cnplex frans((oil2 (usl3)) qnd Complex trans-twifrntB) THust vatet 0Ptilalisamers…

A: coordination compounds are generally tetrahedral, spqare planar and octahedral. bonding direction of…

Q: 4- Which chemical type of absorption bands is the least intense in aqueous solutions? 1) MnCl2 2)…

A: We have to identify which of the given compound will show least intense absorption spectra.

Q: how many IR bands are there in PdL2Cl2?

A: We have to identify IR bands are there in PdL2Cl2 as follows in step 2:

Q: Using the Beer-Lambert's Law, calculate the concentration of the riboflavin with an absorbance of…

Q: what is pseudo order treatment

A: Pseudo is Latin word which means ‘fake’. A Pseudo order reaction can be defined as a bimolecular…

Q: There is a substance in a solution (4 g/liter). The length of cuvette is 2 cm and only 50% of the…

A: Beer-Lambert law is given by,

Q: The relationship between liquid height and optical rotation

A: To give: A relationship between the liquid height and the optical rotation.

Q: Which of the ff. wavelengths will avoid the problem of colored samples during turbidity…

A: Answer Wavelength will avoid the problem of coloured sample…

Q: Nb3Sn and GaV3 are candidates for a superconductive application when the magnetic field is 150,000…

A: Given the critical magnetic field of Nb3Sn, Hc = 150,000 Oe Given the critical magnetic field of…

Q: Using the particle in a box model, the energy of the highest occupied energy level for a linear…

Q: 4. If the protein reacts with the blue (580 nm) dye to form a purple color (550 nm) complex, draw…

A: Protein reacts with blue dye to form a purple complex. We have to draw diagram to show how…

Q: In the Beer's Law plot shown below, what is the Absorbance you should measure for a dye solution…

A: As per Beer-Lambert law, A=εbc Thus, a plot between A and c is a straight line.

Q: The measured optical rotation of polyglutamic acid as a function of wavelength (2) can be fitted by…

Q: For the following structure derived from a tetrahedral Ni(CO)4, please determine the number of…

A: The given molecule has C3 axis of symmetry. It has 3σv and thus its point group will be C3v.

Q: Why HPLC is an important technique in the fields of chemistry . explain with different reasons?

A: The full form of HPLC is High Performance Liquid Chromatography.

Q: Describe how to create metal atomic chains and to measure the G quantization.

A: Answer- The possibility of formation of single-atomic chains by manipulation of nanocontacts is…

Q: What weight Fe2O3 (FW = 159.69) can be obtained from 2.63 g of Fe3O4 (FW = 231.53) by gravimetric…

A: Gravimetric method: In this method, there will accurate measurement of the amount of the product…

Q: Show your work! 8. In an NMR study of a sample of polystyrene, it was determined that (mm) = 0.40…

A: When a molecular backbone contains all the substituents on same side then the molecule is called…

Question

Which of the following statement is
correct?
Chromophores are groups
connected to each other and cause
certain types of molecular
absorption
Bathochromic shift can change the
wavelength to be shorter
Hyperchromic effect leads to longer
wavelength.
None
Auxochromes are groups adjacent to
each other but do not affect the
energy levels.
Hypsochromic effect leads to longer
wavelength,
All

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Metals in Transport, Tranfer and Transcription

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

which subsatomic particles contriubte to the chrage of Cu2+, which do not
Explain the process of Calculating Enantiomeric Excess ?
What is the difference between optical activity/polarimetry vs. (R)/(S) configurations? (+) seems to be clockwise, while (-) seems to be counterclockwise. (R) seems to be clockwise when the lowest priority group is facing the back, while (S) seems to be counterclockwise. Does (R) match up with (+) and (S) match up with (-)? If not, what is the difference? Is it that (R) and (S) are just how we determine the priorities in space while (+) and (-) can be determined via labaratory experiments? How can (R)(-) or (S)(+) exist then? Would this show that the spatial arrangement is incorrect in comparison with what the polarimeter shows?
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)
Can you give an example of homotopic, heterotopic, enantiotopic, and diastereotopic for compounds?
What is needed to understand Homotopic, Enantiotopic, Diasterotopic?
Can facial and meridional isomers be chiral? justify
What, if anything, would happen to the absorbance of a FeSCN2+ solution, if the FeSCN2+ solution was diluted? Explain your answer.
Which is correct for polarography? I-polarography is an amperometry method conducted with a dripping Hg electrode. II-The diffusion current in the plateau region of the polarographic wave is proportional to the concentration of the analyte and is used for quantitative analysis. III-The half-wave potential is characteristic of the analyte in a given environment and can be used for qualitative analysis. IV-fresh Hg drops provide reproducible results. V-polarography is primarily used to study oxidations, Hg can be reduced when studying reductions
Answer Q23, 22, 21
What is the group that shows theeffect of the variable being tested
Solve typed need. Discuss the meaning of the term chirality in organic chemistry in detail? Include in your discussion 10 different ways in which chirality is identified and 10 ways how to determine chirality by designating priority groups in detail.