IUPAC and the omega-nomenclature of LCDs

Q: Given your choice of Flame AA, ICP-AE, XRF, EI-MS, or none of these, and keeping in mind that cost…

A: The function of Flame AA  is to detects the metal present in a sample. The function of ICP-AE is to…

Q: polystysene (styrofoam cue) PerkinElmer Spectrum IR Version 10 6.0 Tuesday March 22, 2022 6:52 PM…

A: IR Spectroscopy tells us about the functional  group present  in the molecules.

Q: 2. 2. 2. C- 5 4. Br 3 Br OCHS CS Scanned with CamScanner

A: The naming of organic compounds based on IUPAC nomenclature system. There are different type of…

Q: Identify some advantages and limitations of using HPLC, and explain

A: When organic mixtures of compounds are nonvolatile, thermally not stable, and have high molecular…

Q: PURITY TEST Instructions: Note the REFRACTIVE INDECES of each of the samples and solve for their %…

A:

Q: Which is better HPLC system Agilent 1290 Infinity II LC or Nexera Series UHPLC? Explain

A: HPLC is High Performance Liquid Chromatography UHPLC is Ultra High Performance Liquid Chromatography

Q: Which is correct for polarography? I-polarography is an amperometry method conducted with a dripping…

A: Polarography technique is used to determine the molecules are oxidation or other reduction at…

Q: It is not of the solute property detector used in HPLC is: a. Refractive index detector b. UV…

A: Mixture components are estimated using HPLC detectors. The actual separation in HPLC (High…

Q: write a brief summary about two-dimensional PtSe2

A: Scientist Minozzi first synthesized PtSe2 in 1909. PtSe2 is a compound of transition metal Pt and…

Q: C. nonelectrical and electrical data domains

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: c. nonelectrical and electrical data domains

A:

Q: Compound X was dissolved in a 5-mL volumetric flask. A 1.00-mL aliquot of the compound was placed in…

A: Given, Absorbance = 0.427 Cuvette length = 1.00 cm Molar absorptivity = 6130 M-1 cm-1  Molecular…

Q: What is IR active and IR inactive?

A: IR spectroscopy corresponds to the transition between the vibrational levels of a molecule.  It…

Q: 1. Define sparging. What is the significance of this step in an HPLC analysis?

A:

Q: 1-proteins-lab-manual?module_item_id=44333 A= abc Where "A" is absorbance, "a" is molar…

A: First question had been answered. Absorbance of a solution can be calculated using Beer Lambert law.

Q: Which are true for polarography?   I         Polarography is amperometry conducted with a dropping…

A: Please find the below text answer.   Thank you

Q: What is a guard column and why is it used in HPLC but not in GC systems?

A: A guard column is a protective column or cartridge installed between the injector and the…

Q: A student prepared a series of starch standards using the iodine method and measured the absorbance…

A: In optics, absorbance or decadic absorbance is defined by the common logarithm of the ratio of…

Q: Please choose an appropriate technique(s) to separate following compounds (it can be one, more than…

A: Column chromatography is a technique in which we can separately get components on the basis of…

Q: Given: F2(2) + 2 e° → 2F (aq) E° = +2.87 v Hg²+ + 2 e → (aq) Hga E° = +0.87 v Calculate AG° for: Hga…

A: Given is  F2 + 2e– ——>    2F–      E° = + 2.87 v  ......eq(1) Hg+2 + 2e– ——> Hg        E° =…

Q: What is piezoelectricity? short discription

A: The pizoelectricity concept was put forward by Paul-Jacques Curie and his younger brother Pierre,…

Q: Gas Chromatography (GC) is one of the useful techniques in analytical chemistry. Give two important…

A: It is one of the most convenient technique for the analysis and separation purposes of molecules in…

Q: Does copper (II) acetate have a d-d or CT intensity?

A: Copper (II) acetate have CT intensity.

Q: This graph shows an absorbance vs concentration curve for Co2"(aq) solution. Sample Standard Curve…

A: The absorbance v/s concentration curve given is,

Q: 1. You know that these types of compounds can be analyzed by either GC or HPLC but you are told by…

A: GC can only apply to  analyse volatile substance while HPLC can handle any soluble compound…

Q: Describe how to prepare adulterated palm oil samples before analysing it with Raman spectrometer.…

A: SOLUTION: Step 1: Palm oil is a bright reddish/orange oil produced from the mesocarp of the fruits…

Q: List the desirable characteristics of HPLC detectors.

A:

Q: volumetric flask. A 1.00-mL aliquot of the compound was placed in a 10-mL volumetric flask and…

A: Here a volumetric flask contains 5 ml of of concentrated solution of compound X. 1ml of the original…

Q: Chemical dyes are used to increase resolution of objects.   True False

A: Chemical dyes are used to increase resolution of objects. This statement is true or false is the…

Q: Many ink dyes can be separated by the technique of___________ chromatography

A: Thin Layer Chromatography is a method for separating non-volatile substances. The separation…

Q: Please complete Table 2 and show the calculations for protein concentration and the concentration of…

A: A question based on tools in analytical chemistry that is to be accomplished.

Q: The concentration of Ba(103)2 in H2O at 35°C (Ksp = 3.00 x 10- %3D Ba(103)2 (s) - Ba²* + 2103 5.23 x…

A: Ksp = 3.00 × 10-9  Concentration of Ba (IO3)2 = ?

Q: describe different type of degasser in HPLC system, and why degassing is important in the middle of…

A: Degasser is  very useful in HPLC .the main use of degasser in HPLC are  hellium sparging, sonication…

Q: Chemistry Calculate Mn Mw Mz n1 100 80 70 50 30 M1 50 40 30 20 10 Example 2. Calculate Mn, Mw for…

A: The number average molecular weight can expressed as: Mn=∑niMi∑ni where, n is the number of…

Q: improve

A: We know that resolution is a measure of how well two Elution peak can be differentiated in…

Q: what chromatography seperation how is tlc part of it

A:

Q: Question 19 In AFM, what is the consequence of low scanning time? limited magnification thermal…

A: AFM refers to Atomic Force Microscopy or Scanning force Microscopy.  It is a high resolution type of…

Q: 3 1 2 1 12 11 10 8 7 6 2 200 180 160 140 120 100 80 60 40 20 HSP-49-696 ppm Cos-05-332 ppm Compound…

A:

Q: Different from GCMS, why is an interface needed when coupling HPLC with MS?

A: In addition to the liquid chromatography and mass spectrometry devices, an LC-MS system contains an…

Q: Which of the following statements are true for Beers Law? 1. Absorbance increases as concentration…

A: ••According to Beer's law , absorbance is directly  proportional to path length through the sample…

Q: Complete these Heck reactions

A: The Heck reaction is the chemical reaction of an unsaturated halide with an alkene in the presence…

Q: c. Use the Table to answer the questions below Concentration (M) Absorbances 0.20 0.36 0.40 0.50…

A: The absorbance of a complex depends mainly on two paramters i.e. concentration of the complex and…

Q: how does the intermolecular force of attraction lead to stain removal? state reference

A: Intermolecular forces are the type of forces operating in between the atoms or ions of different…

Q: For each of the following statements, answer True or False and explain your answer briefly. It is…

A: Color test and micro-crystalline test are used to find the drug present in the system. Different…

Q: CSH9N .4 2114 3295 IR Spectrum (liquid film) 1200 2000 1600 V (cm' ) 4000 3000 800

A:

Q: 0.590164444

A: it may be 'at given concentration of NaCl , absorbance of solution.

Q: .Dscribe The History of Forensic Chemistry? 3.Enumerate and discuss the functions of forensic…

A: 1. The history of Forensic Chemistry : Forensic chemistry is the use of chemical sciences or…

Mass Spectrometry

This process is an instrumental method in which a sample is changed to fast moving positive ions by electron bombardment. The charged particles vary due to their different mass to charge ratio and are estimated with the help of this difference. It is also called mass spectroscopy.